Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17722
Trapped Gene
Vangl1 (ENSMUSG00000027860)
Vector Insertion
Chr 3: 101969411 - 101970760
Public Clones (ggtc) CMHD-GT_258E05-3 (cmhd) IST12304F9 (tigm) IST11559B5 (tigm)
IST10297F10 (tigm) IST14800C12 (tigm) IST10945F5 (tigm) IST11713B12 (tigm)
IST14868F2 (tigm) IST12304F9 (tigm) IST11538E2 (tigm) IST11428C7 (tigm)
IST11428C7 (tigm) IST14418H5 (tigm) IST11985C5 (tigm) IST10995G7 (tigm)
IST10297F10 (tigm) IST12285G4 (tigm) IST12285G4 (tigm) IST10995G7 (tigm)
Private Clones OST437443 (lexicon) OST374395 (lexicon) OST307667 (lexicon) OST238596 (lexicon)
OST33538 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370676 (Chr3:101970761..101970894 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAACCTCCTAACAGCATCC Chr3:101970813..101970832 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370676 (Chr3:101970761..101970894 -)
Downstram Exon
ENSMUSE00000173686 (Chr3:101969278..101969410 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAACCTCCTAACAGCATCC Chr3:101970813..101970832 59.69 55 TACAACTCGTTGTGGCTGGA Chr3:101969304..101969323 60.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453892 Chr3:102008435..102008531 No primer for this exon
upstream ENSMUSE00000453884 Chr3:102000715..102000899 ATCAGACGAAGCTTGCCATT Chr3:102000789..102000808 59.84 45
upstream ENSMUSE00000453879 Chr3:101993332..101993470 AGATGGCAGAGGGTCAGAAA Chr3:101993412..101993431 59.8 50
upstream ENSMUSE00000453875 Chr3:101987874..101988481 CATCGTGCAATACGCAGTCT Chr3:101988013..101988032 59.9 50
upstream ENSMUSE00000370676 Chr3:101970761..101970894 CGAACCTCCTAACAGCATCC Chr3:101970813..101970832 59.69 55

*** Putative Vector Insertion (Chr 3: 101969411 - 101970760) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173686 Chr3:101969278..101969410 TACAACTCGTTGTGGCTGGA Chr3:101969304..101969323 60.3 50
downstream ENSMUSE00000173682 Chr3:101967222..101967456 CATGCTGTGGTAGTGCTGCT Chr3:101967254..101967273 60.08 55
downstream ENSMUSE00000396395 Chr3:101962119..101962420 GAGCCATCGATCCTTGTCAT Chr3:101962336..101962355 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAATCGCCTTGCAGCAC Chr3:101970692..101970712 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCTCGTGACTGGGAAAAC Chr3:101970694..101970714 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCCTCATTTTACAGCATCC Chr3:101970888..101970908 59.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACAAGGACTTCCGTGACTGG Chr3:101970835..101970855 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027860