Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17735
Trapped Gene
Thtpa (ENSMUSG00000045691)
Vector Insertion
Chr 14: 55714844 - 55716216
Public Clones not available
Private Clones OST437214 (lexicon) OST437123 (lexicon) OST411725 (lexicon) OST318308 (lexicon)
OST283911 (lexicon) OST246332 (lexicon) OST206978 (lexicon) OST158246 (lexicon)
OST99886 (lexicon) OST67088 (lexicon) OST42373 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361576 (Chr14:55713672..55714843 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTTGAACTGCTCGGGTCT Chr14:55714571..55714590 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361576 (Chr14:55713672..55714843 +)
Downstram Exon
ENSMUSE00000402561 (Chr14:55716217..55717818 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTTGAACTGCTCGGGTCT Chr14:55714571..55714590 59.99 50 AGGAACCGGTCTCAACAATG Chr14:55716931..55716950 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361576 Chr14:55713672..55714843 TCTTTGAACTGCTCGGGTCT Chr14:55714571..55714590 59.99 50

*** Putative Vector Insertion (Chr 14: 55714844 - 55716216) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402561 Chr14:55716217..55717818 AGGAACCGGTCTCAACAATG Chr14:55716931..55716950 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr14:55714895..55714915 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000045691