Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17748
Trapped Gene
Lax1 (ENSMUSG00000051998)
Vector Insertion
Chr 1: 135585582 - 135586391
Public Clones not available
Private Clones OST437078 (lexicon) OST318829 (lexicon) OST180153 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000466660 (Chr1:135586392..135586593 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGTGGCCCTACTGCTTCA Chr1:135586508..135586527 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000466660 (Chr1:135586392..135586593 -)
Downstram Exon
ENSMUSE00000432719 (Chr1:135585398..135585581 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGTGGCCCTACTGCTTCA Chr1:135586508..135586527 60.01 55 GCCAGTATGGCTTCCACTTT Chr1:135585520..135585539 59.2 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466660 Chr1:135586392..135586593 AGAGTGGCCCTACTGCTTCA Chr1:135586508..135586527 60.01 55

*** Putative Vector Insertion (Chr 1: 135585582 - 135586391) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432719 Chr1:135585398..135585581 GCCAGTATGGCTTCCACTTT Chr1:135585520..135585539 59.2 50
downstream ENSMUSE00000432694 Chr1:135580583..135580686 ACCAGGATGATGGTCAGGAG Chr1:135580608..135580627 59.92 55
downstream ENSMUSE00000432686 Chr1:135580115..135580219 AGGCAGAGTCAACGATGGAG Chr1:135580154..135580173 60.41 55
downstream ENSMUSE00000432704 Chr1:135579560..135579630 CTCAGGGCTGTCAGATGCTC Chr1:135579544..135579563 61.12 60
downstream ENSMUSE00000472713 Chr1:135575677..135577212 TGCTAGTGCCCAGTTCCTCT Chr1:135576268..135576287 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr1:135586322..135586342 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTACCAACTCAGCCTGGAA Chr1:135586396..135586417 59.86 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051998