Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17755
Trapped Gene
Metapl1 (ENSMUSG00000041921)
Vector Insertion
Chr 2: 71344841 - 71345000
Public Clones not available
Private Clones OST436924 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320211 (Chr2:71344842..71344999 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGTCTTCGCCACTCAATC Chr2:71344855..71344874 58.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320211 (Chr2:71344842..71344999 +)
Downstram Exon
ENSMUSE00000690514 (Chr2:71344842..71344999 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGTCTTCGCCACTCAATC Chr2:71344855..71344874 58.96 50 GCCTGACCGCTTGTGTAAGT Chr2:71344903..71344922 60.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715101 Chr2:71291395..71291455 No primer for this exon
upstream ENSMUSE00000721427 Chr2:71291395..71291455 No primer for this exon

*** Putative Vector Insertion (Chr 2: 71344841 - 71345000) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320211 Chr2:71344842..71344999 GCCTGACCGCTTGTGTAAGT Chr2:71344903..71344922 60.32 55
downstream ENSMUSE00000690514 Chr2:71344842..71344999 GCCTGACCGCTTGTGTAAGT Chr2:71344903..71344922 60.32 55
downstream ENSMUSE00000320198 Chr2:71347798..71347947 TGCCTGTCGTCACGTAGTCT Chr2:71347834..71347853 59.49 55
downstream ENSMUSE00000690513 Chr2:71347798..71347947 TGCCTGTCGTCACGTAGTCT Chr2:71347834..71347853 59.49 55
downstream ENSMUSE00000482070 Chr2:71349469..71349617 CCAATGAACAAGCGCATCTA Chr2:71349513..71349532 59.83 45
downstream ENSMUSE00000488431 Chr2:71349469..71349617 CCAATGAACAAGCGCATCTA Chr2:71349513..71349532 59.83 45
downstream ENSMUSE00000644549 Chr2:71350183..71350225 No primer for this exon
downstream ENSMUSE00000690516 Chr2:71352681..71352770 ACCACACCAAAAGGCTTCAC Chr2:71352718..71352737 60.01 50
downstream ENSMUSE00000644548 Chr2:71353694..71353857 CTCTACACCTCCTGGCAACC Chr2:71353799..71353818 59.72 60
downstream ENSMUSE00000439969 Chr2:71355106..71355196 AGGCTGACATGCCCTTTAGA Chr2:71355195..71355214 59.84 50
downstream ENSMUSE00000320153 Chr2:71360590..71360687 GATGCCAAATTTCTGGGTGT Chr2:71360687..71360706 59.8 45
downstream ENSMUSE00000320147 Chr2:71361859..71361906 CATGGGCAGATCATTGTCAT Chr2:71361884..71361903 59.33 45
downstream ENSMUSE00000320141 Chr2:71362774..71362852 CATGCGTCCTCAAGGACTTT Chr2:71362828..71362847 60.26 50
downstream ENSMUSE00000409576 Chr2:71362940..71363223 CGTCCTCTCTGCGTTTTCTC Chr2:71363118..71363137 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:71344891..71344911 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAACGTGACTGGGAAAAC Chr2:71344887..71344907 59.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041921