Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17765
Trapped Gene
Wdr5 (ENSMUSG00000026917)
Vector Insertion
Chr 2: 27389376 - 27390276
Public Clones not available
Private Clones OST436755 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164108 (Chr2:27389288..27389375 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAATCTGCAGACCAAGGAG Chr2:27389328..27389347 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164108 (Chr2:27389288..27389375 +)
Downstram Exon
ENSMUSE00000351726 (Chr2:27390277..27392053 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAATCTGCAGACCAAGGAG Chr2:27389328..27389347 59.8 55 CTGAGCTTGGCCACTACCTC Chr2:27391378..27391397 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377460 Chr2:27370726..27370800 No primer for this exon
upstream ENSMUSE00000229041 Chr2:27374149..27374312 CATTGTGACTCCCCCTTCAC Chr2:27374184..27374203 60.36 55
upstream ENSMUSE00000164104 Chr2:27374869..27374977 AAGCCAAACTATGCCCTGAA Chr2:27374881..27374900 59.71 45
upstream ENSMUSE00000164109 Chr2:27375263..27375336 ATTTGGGGAGCATATGATGG Chr2:27375283..27375302 59.6 45
upstream ENSMUSE00000164111 Chr2:27375847..27375936 CCTTGTGTCTGCCTCTGATG Chr2:27375885..27375904 59.42 55
upstream ENSMUSE00000164106 Chr2:27376093..27376182 CCAGTCCAACCTCATCGTCT Chr2:27376155..27376174 60.11 55
upstream ENSMUSE00000164101 Chr2:27376348..27376431 TGTGAGGATATGGGACGTGA Chr2:27376359..27376378 59.92 50
upstream ENSMUSE00000164112 Chr2:27380626..27380681 CCGTGATGGATCATTGATTG Chr2:27380637..27380656 59.73 45
upstream ENSMUSE00000164110 Chr2:27383794..27383840 CCTCTGGCCAGTGTCTGAAG Chr2:27383811..27383830 61 60
upstream ENSMUSE00000697539 Chr2:27386472..27386519 GTGACCAGTCACGAGAAACG Chr2:27386477..27386496 59.31 55
upstream ENSMUSE00000164105 Chr2:27387159..27387234 CAAATACATCCTGGCTGCAA Chr2:27387205..27387224 59.69 45
upstream ENSMUSE00000164113 Chr2:27388513..27388546 GCTCTGGGACTACAGCAAGG Chr2:27388522..27388541 60.01 60
upstream ENSMUSE00000164103 Chr2:27388857..27388931 ATTTGCCAACTTCTCCGTGA Chr2:27388901..27388920 60.64 45
upstream ENSMUSE00000164108 Chr2:27389288..27389375 GGAATCTGCAGACCAAGGAG Chr2:27389328..27389347 59.8 55

*** Putative Vector Insertion (Chr 2: 27389376 - 27390276) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351726 Chr2:27390277..27392053 CTGAGCTTGGCCACTACCTC Chr2:27391378..27391397 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026917