Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1777
Trapped Gene
Mier3 (ENSMUSG00000032727)
Vector Insertion
Chr 13: 112481590 - 112493836
Public Clones CA0213 (sanger) CF0172 (sanger) RRR648 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679693 (Chr13:112481444..112481589 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGACGGGAAGAACTTCAG Chr13:112481545..112481564 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679693 (Chr13:112481444..112481589 +)
Downstram Exon
ENSMUSE00000388133 (Chr13:112493837..112493971 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGACGGGAAGAACTTCAG Chr13:112481545..112481564 59.84 55 GGTCTTCTAGCGGCATGTTC Chr13:112493864..112493883 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715767 Chr13:112476386..112476562 GTTCGCCCTAAAGGTACCAA Chr13:112476533..112476552 59.09 50
upstream ENSMUSE00000716419 Chr13:112476386..112476562 GTTCGCCCTAAAGGTACCAA Chr13:112476533..112476552 59.09 50
upstream ENSMUSE00000679687 Chr13:112476533..112476562 GTTCGCCCTAAAGGTACCAA Chr13:112476533..112476552 59.09 50
upstream ENSMUSE00000639801 Chr13:112476559..112476662 No primer for this exon
upstream ENSMUSE00000365100 Chr13:112478036..112478060 GCTTCCTTTGGAAGTTCGAG Chr13:112478036..112478055 59.05 50
upstream ENSMUSE00000679698 Chr13:112478036..112478060 GCTTCCTTTGGAAGTTCGAG Chr13:112478036..112478055 59.05 50
upstream ENSMUSE00000410625 Chr13:112481444..112481589 GACGACGGGAAGAACTTCAG Chr13:112481545..112481564 59.84 55
upstream ENSMUSE00000679693 Chr13:112481444..112481589 GACGACGGGAAGAACTTCAG Chr13:112481545..112481564 59.84 55
upstream ENSMUSE00000714937 Chr13:112481444..112481589 GACGACGGGAAGAACTTCAG Chr13:112481545..112481564 59.84 55

*** Putative Vector Insertion (Chr 13: 112481590 - 112493836) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000388133 Chr13:112493837..112493971 GGTCTTCTAGCGGCATGTTC Chr13:112493864..112493883 59.84 55
downstream ENSMUSE00000316325 Chr13:112495430..112495550 CAGGTCTTTCGCGATCTCTT Chr13:112495453..112495472 59.57 50
downstream ENSMUSE00000316316 Chr13:112496210..112496295 CCTCAATCTCGGACTCCTTG Chr13:112496254..112496273 59.8 55
downstream ENSMUSE00000316307 Chr13:112496846..112496921 CTTTCTCGTCGTCACCATTG Chr13:112496924..112496943 59.29 50
downstream ENSMUSE00000316300 Chr13:112498422..112498573 CACACCAGGATGCCACAGTA Chr13:112498465..112498484 60.59 55
downstream ENSMUSE00000316293 Chr13:112499934..112500015 GATGCCTTTCCATTACAGCA Chr13:112500013..112500032 58.72 45
downstream ENSMUSE00000679689 Chr13:112501894..112501988 ATGTTCAAAGCTTCGGCACT Chr13:112501943..112501962 59.88 45
downstream ENSMUSE00000316287 Chr13:112501897..112501988 AAAGCTTCGGCACTCCTCTT Chr13:112501937..112501956 60.52 50
downstream ENSMUSE00000316283 Chr13:112504449..112504576 GGCAACCGTTCTAGACCTCA Chr13:112504472..112504491 60.26 55
downstream ENSMUSE00000316276 Chr13:112504653..112504795 ACTGACGGTACCACCCAGAG Chr13:112504710..112504729 60.03 60
downstream ENSMUSE00000373670 Chr13:112504892..112507844 GCTGCACATGGGGTTTAACT Chr13:112505109..112505128 60 50
downstream ENSMUSE00000679688 Chr13:112504892..112508802 GCTGCACATGGGGTTTAACT Chr13:112505109..112505128 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTAATCGCCTTGCAGCAC Chr13:112484638..112484658 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGACGGGAAGAACTTCAGC Chr13:112484547..112484567 61.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032727