Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17777
Trapped Gene
Bbs9 (ENSMUSG00000035919)
Vector Insertion
Chr 9: 22308554 - 22318423
Public Clones not available
Private Clones OST436622 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000422423 (Chr9:22308489..22308553 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCGGAAGCTCTGTGTCTA Chr9:22308523..22308542 60.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000422423 (Chr9:22308489..22308553 +)
Downstram Exon
ENSMUSE00000333776 (Chr9:22318424..22318537 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCGGAAGCTCTGTGTCTA Chr9:22308523..22308542 60.93 55 TACACCACCAAAGGGTCCAT Chr9:22318536..22318555 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422462 Chr9:22280189..22280499 TTGGGAACGTGGAAAACTTC Chr9:22280459..22280478 59.95 45
upstream ENSMUSE00000422449 Chr9:22295262..22295384 CCCGTGACTGGTGGTCTACT Chr9:22295289..22295308 60.03 60
upstream ENSMUSE00000422429 Chr9:22301153..22301303 TGGAAGTCGGGAAGTTTGTC Chr9:22301282..22301301 60.09 50
upstream ENSMUSE00000422423 Chr9:22308489..22308553 TCCCGGAAGCTCTGTGTCTA Chr9:22308523..22308542 60.93 55

*** Putative Vector Insertion (Chr 9: 22308554 - 22318423) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333776 Chr9:22318424..22318537 TACACCACCAAAGGGTCCAT Chr9:22318536..22318555 60.09 50
downstream ENSMUSE00000392637 Chr9:22372149..22372323 CTCCCAAACGCATAGCTTTC Chr9:22372227..22372246 59.85 50
downstream ENSMUSE00000281096 Chr9:22379555..22379639 ACTAGCCGCTTTCCAGAACC Chr9:22379641..22379660 60.76 55
downstream ENSMUSE00000281078 Chr9:22383081..22383264 TCGAATCTGCCCATTATCCT Chr9:22383215..22383234 59.49 45
downstream ENSMUSE00000281061 Chr9:22383908..22384037 TGCAGCATGTGGTTATGGTT Chr9:22383962..22383981 59.99 45
downstream ENSMUSE00000280973 Chr9:22433386..22433564 AGAAGGGTCTGTCCCCAGAT Chr9:22433464..22433483 59.93 55
downstream ENSMUSE00000280946 Chr9:22440055..22440131 TGTTCAGTCAAGGGCCAAAC Chr9:22440079..22440098 61.08 50
downstream ENSMUSE00000280929 Chr9:22443174..22443227 GTGATGGACGGGACAGAGTC Chr9:22443223..22443242 60.54 60
downstream ENSMUSE00000280891 Chr9:22448189..22448291 CTTGACCTTCTGCAACACCA Chr9:22448230..22448249 59.87 50
downstream ENSMUSE00000362135 Chr9:22450408..22450512 CCTTCTAACTCGGATGGTGTG Chr9:22450482..22450502 59.6 52.38
downstream ENSMUSE00000702380 Chr9:22452464..22452478 No primer for this exon
downstream ENSMUSE00000362779 Chr9:22459669..22459809 TTGGACAACCCGAGGAATAC Chr9:22459691..22459710 59.79 50
downstream ENSMUSE00000379729 Chr9:22463494..22463589 TAGGAGACGGAAGCCCATTA Chr9:22463552..22463571 59.66 50
downstream ENSMUSE00000341359 Chr9:22475229..22475401 CGGAGGATGAGTTCATTGGT Chr9:22475298..22475317 59.93 50
downstream ENSMUSE00000377404 Chr9:22483356..22483508 CTGAATGGCCCGAAATTGTA Chr9:22483427..22483446 60.83 45
downstream ENSMUSE00000280795 Chr9:22598195..22598377 AAATGGGTGGCACTCTTCAG Chr9:22598280..22598299 60.11 50
downstream ENSMUSE00000280764 Chr9:22616765..22616987 TCTTCGACAGGCAGGTTTTC Chr9:22616828..22616847 60.38 50
downstream ENSMUSE00000280735 Chr9:22692025..22692132 TGAGGTGCTTGTGGTTGGTA Chr9:22692114..22692133 60.15 50
downstream ENSMUSE00000354999 Chr9:22692306..22692718 AGGCAGCAACCATTTTCTTG Chr9:22692560..22692579 60.25 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCGGAAGCTCTGTGTCTAC Chr9:22311525..22311545 59.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCGGAAGCTCTGTGTCTAC Chr9:22311525..22311545 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035919