Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17795
Trapped Gene
C1qdc1 (ENSMUSG00000030309)
Vector Insertion
Chr 6: 148826503 - 148831969
Public Clones not available
Private Clones OST436321 (lexicon) OST56086 (lexicon) OST42930 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000545143 (Chr6:148831970..148832056 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATTTGCCAAGGAGCTTCA Chr6:148831998..148832017 60.33 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000545143 (Chr6:148831970..148832056 -)
Downstram Exon
ENSMUSE00000519632 (Chr6:148826264..148826502 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATTTGCCAAGGAGCTTCA Chr6:148831998..148832017 60.33 45 ATTCAAGCCCCCTTTGAAGT Chr6:148826328..148826347 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460387 Chr6:148844540..148844672 No primer for this exon
upstream ENSMUSE00000688326 Chr6:148844540..148844759 No primer for this exon
upstream ENSMUSE00000509931 Chr6:148843459..148843678 CAAGTGAACCAGGATCAGCA Chr6:148843598..148843617 59.83 50
upstream ENSMUSE00000719715 Chr6:148843459..148843678 CAAGTGAACCAGGATCAGCA Chr6:148843598..148843617 59.83 50
upstream ENSMUSE00000545144 Chr6:148839131..148839193 AGCAGCTTAACCCAGACCAG Chr6:148839134..148839153 59.5 55
upstream ENSMUSE00000545143 Chr6:148831970..148832056 GAATTTGCCAAGGAGCTTCA Chr6:148831998..148832017 60.33 45

*** Putative Vector Insertion (Chr 6: 148826503 - 148831969) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000519632 Chr6:148826264..148826502 ATTCAAGCCCCCTTTGAAGT Chr6:148826328..148826347 59.94 45
downstream ENSMUSE00000332556 Chr6:148824975..148825057 GGATGACTGCTCCATCTGGT Chr6:148825008..148825027 60.08 55
downstream ENSMUSE00000517869 Chr6:148821530..148821685 GCAGCAATTTAGACAGCAGGT Chr6:148821628..148821648 59.54 47.62
downstream ENSMUSE00000545142 Chr6:148819135..148819178 CTTGTGGCTGTATCTCTGGTTG Chr6:148819115..148819136 59.8 50
downstream ENSMUSE00000688320 Chr6:148817511..148818167 AGGATCTGCTGCCACTCTGT Chr6:148817686..148817705 60.02 55
downstream ENSMUSE00000545141 Chr6:148814352..148814474 GCTCATGAGGTCCTGCAGTT Chr6:148814360..148814379 60.42 55
downstream ENSMUSE00000545140 Chr6:148812025..148812094 TTGCACTTGAGGGTTTGTCA Chr6:148812036..148812055 60.28 45
downstream ENSMUSE00000545139 Chr6:148810926..148810990 TGGTTGGACAAGTTTTGTTCTG Chr6:148810932..148810953 60.04 40.91
downstream ENSMUSE00000545138 Chr6:148809009..148809110 AGATCCCGAAGAAGCCTGAT Chr6:148809020..148809039 60.18 50
downstream ENSMUSE00000466454 Chr6:148807123..148807263 GCTTCTGAACTCCCACTTGC Chr6:148807135..148807154 60 55
downstream ENSMUSE00000461368 Chr6:148799797..148799965 TGGCATTGGGATACTGTCTG Chr6:148799822..148799841 59.52 50
downstream ENSMUSE00000473731 Chr6:148796628..148796813 CAGAGTCCCCCGACTACTGA Chr6:148796670..148796689 60.25 60
downstream ENSMUSE00000474736 Chr6:148794675..148794775 GCTGGCTGTAATTCCCACTT Chr6:148794700..148794719 59.2 50
downstream ENSMUSE00000473180 Chr6:148793694..148793757 TTGAATTTGCCTGAAGACCAC Chr6:148793675..148793695 60.1 42.86
downstream ENSMUSE00000471105 Chr6:148791015..148791920 CATAAATCGCTCCCCTGTGT Chr6:148791383..148791402 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTGTCCCTTGGCAAGAAT Chr6:148828933..148828953 60.49 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTGTCCCTTGGCAAGAAT Chr6:148828933..148828953 60.49 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030309