Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17796
Trapped Gene
Napb (ENSMUSG00000027438)
Vector Insertion
Chr 2: 148535170 - 148538410
Public Clones not available
Private Clones OST436312 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000397431 (Chr2:148538411..148538490 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGATGGCCAAGAACTGGAG Chr2:148538413..148538432 59.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000397431 (Chr2:148538411..148538490 -)
Downstram Exon
ENSMUSE00000169612 (Chr2:148535053..148535169 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGATGGCCAAGAACTGGAG Chr2:148538413..148538432 59.28 50 AGCTTGACAAAACGCATTCC Chr2:148535122..148535141 60.26 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000356787 Chr2:148558002..148558203 CTCTTTCCTCCGAGGGTTGT Chr2:148558006..148558025 60.62 55
upstream ENSMUSE00000397431 Chr2:148538411..148538490 AAGATGGCCAAGAACTGGAG Chr2:148538413..148538432 59.28 50

*** Putative Vector Insertion (Chr 2: 148535170 - 148538410) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169612 Chr2:148535053..148535169 AGCTTGACAAAACGCATTCC Chr2:148535122..148535141 60.26 45
downstream ENSMUSE00000169615 Chr2:148532895..148532941 TGTCGATGGCTGCATTTAAG Chr2:148532887..148532906 59.83 45
downstream ENSMUSE00000557060 Chr2:148532682..148532759 CTCGGCAATGGTGATATGGT Chr2:148532693..148532712 60.74 50
downstream ENSMUSE00000661465 Chr2:148529006..148529061 No primer for this exon
downstream ENSMUSE00000661464 Chr2:148528797..148528881 GCAGACACTTGTTGGCAGAG Chr2:148528840..148528859 59.62 55
downstream ENSMUSE00000557052 Chr2:148526109..148526213 ACAAGGGGTTATCCATGGTG Chr2:148526161..148526180 59.53 50
downstream ENSMUSE00000169616 Chr2:148524667..148524735 GGAGTCCGTAAATGCTGGAA Chr2:148524666..148524685 60.07 50
downstream ENSMUSE00000169614 Chr2:148523919..148523969 CGCTTCACTGTTCTGTTCCTC Chr2:148523909..148523929 60.04 52.38
downstream ENSMUSE00000373709 Chr2:148521028..148523242 CTAGGGCCATCCAAAGATGA Chr2:148521828..148521847 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGATCTCATGATGTGGA Chr2:148535389..148535409 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGATCTCATGATGTGGA Chr2:148535389..148535409 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027438