Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17797
Trapped Gene
Cdk9 (ENSMUSG00000009555)
Vector Insertion
Chr 2: 32563810 - 32564986
Public Clones not available
Private Clones OST436294 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162974 (Chr2:32564987..32565135 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162974 (Chr2:32564987..32565135 -)
Downstram Exon
ENSMUSE00000274128 (Chr2:32563305..32563809 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377506 Chr2:32568085..32568275 No primer for this exon
upstream ENSMUSE00000717079 Chr2:32567730..32567787 No primer for this exon
upstream ENSMUSE00000162980 Chr2:32567551..32567632 No primer for this exon
upstream ENSMUSE00000717745 Chr2:32567551..32567632 No primer for this exon
upstream ENSMUSE00000162981 Chr2:32565997..32566087 No primer for this exon
upstream ENSMUSE00000162982 Chr2:32565563..32565729 No primer for this exon
upstream ENSMUSE00000463305 Chr2:32565293..32565464 No primer for this exon
upstream ENSMUSE00000162974 Chr2:32564987..32565135 No primer for this exon

*** Putative Vector Insertion (Chr 2: 32563810 - 32564986) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274128 Chr2:32563305..32563809 No primer for this exon
downstream ENSMUSE00000721082 Chr2:32562964..32563809 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTAATCGCCTTGCAGCAC Chr2:32564918..32564938 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000009555