Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17802
Trapped Gene
2210021J22Rik (ENSMUSG00000064284)
Vector Insertion
Chr 15: 85638798 - 85639641
Public Clones not available
Private Clones OST436200 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000407572 (Chr15:85639642..85639754 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACAGCTATGTGGGGCAGAA Chr15:85639666..85639685 59.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000407572 (Chr15:85639642..85639754 -)
Downstram Exon
ENSMUSE00000390783 (Chr15:85638686..85638797 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACAGCTATGTGGGGCAGAA Chr15:85639666..85639685 59.3 50 AGAAACCTGGCCTTGTCTGA Chr15:85638716..85638735 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680217 Chr15:85642069..85642089 No primer for this exon
upstream ENSMUSE00000680216 Chr15:85641332..85641478 GACCCAGCAATTTACGGAGA Chr15:85641433..85641452 60.07 50
upstream ENSMUSE00000407572 Chr15:85639642..85639754 TACAGCTATGTGGGGCAGAA Chr15:85639666..85639685 59.3 50

*** Putative Vector Insertion (Chr 15: 85638798 - 85639641) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390783 Chr15:85638686..85638797 AGAAACCTGGCCTTGTCTGA Chr15:85638716..85638735 59.84 50
downstream ENSMUSE00000647099 Chr15:85637419..85637968 GCTGGATACACCCCTGATGT Chr15:85637650..85637669 59.81 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000064284