Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17811
Trapped Gene
Hdx (ENSMUSG00000034551)
Vector Insertion
Chr X: 108714435 - 108735909
Public Clones not available
Private Clones OST436080 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294076 (ChrX:108735910..108736056 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGACCGAGACTTGGCTA ChrX:108736017..108736036 59.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294076 (ChrX:108735910..108736056 -)
Downstram Exon
ENSMUSE00000294066 (ChrX:108714227..108714434 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGACCGAGACTTGGCTA ChrX:108736017..108736036 59.03 55 TTGCTTCGGACAAACAGATG ChrX:108714214..108714233 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653924 ChrX:108810576..108810688 CCTGGTCTCATCTTGGAACC ChrX:108810609..108810628 59.51 55
upstream ENSMUSE00000695524 ChrX:108784952..108785098 TGTGCACAGGAGACTAAGCTG ChrX:108784970..108784990 59.25 52.38
upstream ENSMUSE00000695520 ChrX:108773243..108774352 AAGCCAGCAATCTTCTTGGA ChrX:108774199..108774218 59.96 45
upstream ENSMUSE00000294086 ChrX:108763446..108763499 TGCCTTGGATTACAGGGTGT ChrX:108763461..108763480 60.38 50
upstream ENSMUSE00000294076 ChrX:108735910..108736056 CAGTGACCGAGACTTGGCTA ChrX:108736017..108736036 59.03 55

*** Putative Vector Insertion (Chr X: 108714435 - 108735909) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294066 ChrX:108714227..108714434 TTGCTTCGGACAAACAGATG ChrX:108714214..108714233 59.84 45
downstream ENSMUSE00000294057 ChrX:108706570..108706649 TCATCCTTATGTGCCCTGGT ChrX:108706579..108706598 60.34 50
downstream ENSMUSE00000294046 ChrX:108702804..108702887 CCTCAGAATTGCTTATCATGTCA ChrX:108702814..108702836 59.24 39.13
downstream ENSMUSE00000294038 ChrX:108696404..108696526 No primer for this exon
downstream ENSMUSE00000377382 ChrX:108688813..108691007 TCCCCAGTGTCAGGAGTACC ChrX:108690258..108690277 59.96 60
downstream ENSMUSE00000695509 ChrX:108683544..108691007 AGATCCCCTAGCAGAGCACA ChrX:108687652..108687671 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCAAAACCCAGAATGGAG ChrX:108729932..108729952 59.9 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCAAAACCCAGAATGGAG ChrX:108729932..108729952 59.9 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034551