Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17814
Trapped Gene
Lyrm5 (ENSMUSG00000040370)
Vector Insertion
Chr 6: 145163703 - 145163792
Public Clones not available
Private Clones OST436008 (lexicon) OST96007 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000280866 (Chr6:145163042..145163791 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAAAATGGCCAATTCGTT Chr6:145163741..145163760 59.81 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000280866 (Chr6:145163042..145163791 +)
Downstram Exon
ENSMUSE00000710310 (Chr6:145163704..145163791 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAAAATGGCCAATTCGTT Chr6:145163741..145163760 59.81 40 AACGAATTGGCCATTTTCAC Chr6:145163763..145163782 59.81 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688767 Chr6:145159654..145159996 AGAGCTGCGTCTCACACTGA Chr6:145159806..145159825 59.92 55
upstream ENSMUSE00000505978 Chr6:145159676..145159772 TCTGAGCAAGCTGTCGTCTG Chr6:145159729..145159748 60.49 55
upstream ENSMUSE00000688759 Chr6:145159695..145159764 TCTGAGCAAGCTGTCGTCTG Chr6:145159729..145159748 60.49 55
upstream ENSMUSE00000688765 Chr6:145159695..145159772 TCTGAGCAAGCTGTCGTCTG Chr6:145159729..145159748 60.49 55
upstream ENSMUSE00000688757 Chr6:145159706..145159764 TCTGAGCAAGCTGTCGTCTG Chr6:145159729..145159748 60.49 55
upstream ENSMUSE00000688754 Chr6:145159720..145159772 TCTGAGCAAGCTGTCGTCTG Chr6:145159729..145159748 60.49 55
upstream ENSMUSE00000280866 Chr6:145163042..145163791 GTGAAAATGGCCAATTCGTT Chr6:145163741..145163760 59.81 40
upstream ENSMUSE00000688752 Chr6:145163042..145163065 AAGCACCGAGTCAAAAGCAT Chr6:145163045..145163064 59.88 45
upstream ENSMUSE00000688763 Chr6:145163042..145163304 ATCAAGCCAAGCCTTGAGAG Chr6:145163262..145163281 59.57 50
upstream ENSMUSE00000688751 Chr6:145163285..145163791 GTGAAAATGGCCAATTCGTT Chr6:145163741..145163760 59.81 40

*** Putative Vector Insertion (Chr 6: 145163703 - 145163792) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688769 Chr6:145163704..145163791 AACGAATTGGCCATTTTCAC Chr6:145163763..145163782 59.81 40
downstream ENSMUSE00000710310 Chr6:145163704..145163791 AACGAATTGGCCATTTTCAC Chr6:145163763..145163782 59.81 40
downstream ENSMUSE00000280858 Chr6:145163871..145165459 ACTGGTGCAATGATTGGTCA Chr6:145164106..145164125 59.97 45
downstream ENSMUSE00000688750 Chr6:145163871..145164254 TTGGATAGTCCCGTCCAAGA Chr6:145163901..145163920 60.45 50
downstream ENSMUSE00000688758 Chr6:145163871..145164291 TTGGATAGTCCCGTCCAAGA Chr6:145163901..145163920 60.45 50
downstream ENSMUSE00000688762 Chr6:145163871..145165059 ACTGGTGCAATGATTGGTCA Chr6:145164106..145164125 59.97 45
downstream ENSMUSE00000688766 Chr6:145163871..145164311 TTGGATAGTCCCGTCCAAGA Chr6:145163901..145163920 60.45 50
downstream ENSMUSE00000688768 Chr6:145163871..145165056 ACTGGTGCAATGATTGGTCA Chr6:145164106..145164125 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAGTGAAAATGGCCCGTGA Chr6:145163739..145163759 61.39 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040370