Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17824
Trapped Gene
Tbc1d19 (ENSMUSG00000039178)
Vector Insertion
Chr 5: 54201098 - 54220588
Public Clones not available
Private Clones OST435514 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000352068 (Chr5:54200915..54201097 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCAGATCGTCCAGAAACTC Chr5:54201036..54201055 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000352068 (Chr5:54200915..54201097 +)
Downstram Exon
ENSMUSE00000278491 (Chr5:54220589..54220661 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCAGATCGTCCAGAAACTC Chr5:54201036..54201055 59.65 55 TCGAGTCTGATCTCGGGTCT Chr5:54220623..54220642 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352068 Chr5:54200915..54201097 CCCAGATCGTCCAGAAACTC Chr5:54201036..54201055 59.65 55

*** Putative Vector Insertion (Chr 5: 54201098 - 54220588) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000278491 Chr5:54220589..54220661 TCGAGTCTGATCTCGGGTCT Chr5:54220623..54220642 59.94 55
downstream ENSMUSE00000278480 Chr5:54221694..54221739 No primer for this exon
downstream ENSMUSE00000278472 Chr5:54224209..54224284 GGGTGCAGAAGGATGACTTG Chr5:54224242..54224261 60.66 55
downstream ENSMUSE00000278462 Chr5:54226411..54226485 No primer for this exon
downstream ENSMUSE00000278452 Chr5:54227835..54227898 CTCATCCGTTCCCATCTCAT Chr5:54227897..54227916 59.89 50
downstream ENSMUSE00000278445 Chr5:54229163..54229209 GCATAAACGGGTCGAAAAAG Chr5:54229193..54229212 59.59 45
downstream ENSMUSE00000278437 Chr5:54229366..54229476 TAATTTGGGTTGCGGAGATT Chr5:54229397..54229416 59.41 40
downstream ENSMUSE00000278428 Chr5:54237440..54237512 No primer for this exon
downstream ENSMUSE00000278422 Chr5:54239401..54239439 TTTCTGCCCAATACGCACAT Chr5:54239441..54239460 61.42 45
downstream ENSMUSE00000278416 Chr5:54241077..54241189 AGTGCTGTGGGACTTCCTTG Chr5:54241143..54241162 60.3 55
downstream ENSMUSE00000278407 Chr5:54248087..54248161 AAGGTCGTGCTGGATCACAT Chr5:54248140..54248159 60.54 50
downstream ENSMUSE00000278396 Chr5:54251383..54251445 CATTGCTTGCTGTCAGCTTC Chr5:54251410..54251429 59.75 50
downstream ENSMUSE00000278388 Chr5:54263492..54263576 GGCCCAGTACAGACGTATCC Chr5:54263534..54263553 59.43 60
downstream ENSMUSE00000278377 Chr5:54266126..54266170 CATTGGGCGGATAGAAAACA Chr5:54266173..54266192 60.83 45
downstream ENSMUSE00000278367 Chr5:54274901..54274933 CATGGAAAACCCATGGAAAG Chr5:54274932..54274951 60.16 45
downstream ENSMUSE00000278360 Chr5:54278593..54278702 TCTGAAGAAAAAGCGGACGTA Chr5:54278677..54278697 60 42.86
downstream ENSMUSE00000278352 Chr5:54280555..54280646 GCTCCAATTTCTCGCAGATG Chr5:54280643..54280662 60.88 50
downstream ENSMUSE00000278342 Chr5:54288230..54288345 GAAAAAGCTCGAACCATCCA Chr5:54288271..54288290 60.19 45
downstream ENSMUSE00000278332 Chr5:54292816..54292886 CCTCCATCAGGTTCACTGCT Chr5:54292866..54292885 60.26 55
downstream ENSMUSE00000406700 Chr5:54294571..54294744 TCAGGTGACGGTAGCAAACA Chr5:54294648..54294667 60.3 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAAAAGGAGCCCCTAATCG Chr5:54207135..54207155 60.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACCGTGACTGGGAAAAC Chr5:54207144..54207164 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039178