Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17833
Trapped Gene
Zfp239 (ENSMUSG00000079412)
Vector Insertion
Chr 6: 117813161 - 117820273
Public Clones IST12869E3 (tigm)
Private Clones OST435293 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709564 (Chr6:117813102..117813160 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTCCTGCGTTACCAGGTG Chr6:117813122..117813141 60.71 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709564 (Chr6:117813102..117813160 +)
Downstram Exon
ENSMUSE00000693439 (Chr6:117820274..117820752 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTCCTGCGTTACCAGGTG Chr6:117813122..117813141 60.71 60 CAGCACATGCCAGTATGGTC Chr6:117820479..117820498 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709564 Chr6:117813102..117813160 GAGTCCTGCGTTACCAGGTG Chr6:117813122..117813141 60.71 60

*** Putative Vector Insertion (Chr 6: 117813161 - 117820273) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693439 Chr6:117820274..117820752 CAGCACATGCCAGTATGGTC Chr6:117820479..117820498 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTTACCAGGTGTGGGTTCT Chr6:117819131..117819151 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGTACCTTTCCGTGACTGG Chr6:117819200..117819221 58.97 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079412