Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17869
Trapped Gene
Pigf (ENSMUSG00000024145)
Vector Insertion
Chr 17: 87423254 - 87424637
Public Clones not available
Private Clones OST434609 (lexicon) OST431305 (lexicon) OST431302 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138681 (Chr17:87424638..87424730 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138681 (Chr17:87424638..87424730 -)
Downstram Exon
ENSMUSE00000138675 (Chr17:87423005..87423253 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACGAAGAAGGACGGAATGAA Chr17:87423119..87423138 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000138681 Chr17:87424638..87424730 No primer for this exon

*** Putative Vector Insertion (Chr 17: 87423254 - 87424637) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138675 Chr17:87423005..87423253 ACGAAGAAGGACGGAATGAA Chr17:87423119..87423138 59.67 45
downstream ENSMUSE00000138683 Chr17:87421199..87421290 No primer for this exon
downstream ENSMUSE00000138685 Chr17:87419741..87419857 AAAACGTTTCCAGCACCAAC Chr17:87419816..87419835 60.01 45
downstream ENSMUSE00000138677 Chr17:87408143..87408251 GCCACGCTCCTGTGAAACTA Chr17:87408165..87408184 61.38 55
downstream ENSMUSE00000138679 Chr17:87396599..87396907 TCCAGAGTGGCGAGATAACC Chr17:87396813..87396832 60.22 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCGGGAGAGTTAGGTAAG Chr17:87424631..87424651 60.09 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCGGGAGAGTTAGGTAAG Chr17:87424631..87424651 60.09 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024145