Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17871
Trapped Gene
1110012M11Rik (ENSMUSG00000031813)
Vector Insertion
Chr 8: 74069250 - 74069445
Public Clones not available
Private Clones OST434563 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213287 (Chr8:74069123..74069249 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAAGACCGTGCCTGGATACC Chr8:74069220..74069239 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213287 (Chr8:74069123..74069249 +)
Downstram Exon
ENSMUSE00000213291 (Chr8:74069446..74069565 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAAGACCGTGCCTGGATACC Chr8:74069220..74069239 59.96 55 TGGATTTCTTGCACCAGATG Chr8:74069486..74069505 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000330792 Chr8:74066829..74066956 GAGGGCTGTAGCTGCCTTCT Chr8:74066838..74066857 61.06 60
upstream ENSMUSE00000213294 Chr8:74067032..74067130 GAAAGCCGGCTACTTCCTGT Chr8:74067085..74067104 60.76 55
upstream ENSMUSE00000213288 Chr8:74067286..74067382 ATGCAGATCGTGATGGACAA Chr8:74067313..74067332 60.08 45
upstream ENSMUSE00000213287 Chr8:74069123..74069249 TAAGACCGTGCCTGGATACC Chr8:74069220..74069239 59.96 55

*** Putative Vector Insertion (Chr 8: 74069250 - 74069445) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213291 Chr8:74069446..74069565 TGGATTTCTTGCACCAGATG Chr8:74069486..74069505 59.65 45
downstream ENSMUSE00000213293 Chr8:74069649..74069755 AGTCGGTCCTCCGTAGAGTG Chr8:74069722..74069741 59.33 60
downstream ENSMUSE00000213284 Chr8:74070872..74070933 GTAAAGGGGACTCCGTCCAT Chr8:74070896..74070915 60.19 55
downstream ENSMUSE00000213289 Chr8:74071477..74071533 CTGCCAGTGATTTGATCGTC Chr8:74071522..74071541 59.24 50
downstream ENSMUSE00000330718 Chr8:74071661..74071923 GCGTTTACTGCTGGTGCATA Chr8:74071914..74071933 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGACTAAGACCGTGCCTGGA Chr8:74069217..74069237 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACTAAGACCGTGCCTGGA Chr8:74069217..74069237 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031813