Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17873
Trapped Gene
Arl8a (ENSMUSG00000026426)
Vector Insertion
Chr 1: 137049129 - 137049369
Public Clones not available
Private Clones OST434546 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000241913 (Chr1:137049048..137049128 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAACATGCGAAAAATCACC Chr1:137049088..137049107 59.52 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000241913 (Chr1:137049048..137049128 +)
Downstram Exon
ENSMUSE00000241905 (Chr1:137049370..137049443 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAACATGCGAAAAATCACC Chr1:137049088..137049107 59.52 40 AGTAGCGTTCCCACATGCTT Chr1:137049424..137049443 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423940 Chr1:137043411..137043677 GACCATGATCGCTTTGTTCA Chr1:137043551..137043570 59.65 45
upstream ENSMUSE00000241913 Chr1:137049048..137049128 TCAACATGCGAAAAATCACC Chr1:137049088..137049107 59.52 40

*** Putative Vector Insertion (Chr 1: 137049129 - 137049369) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000241905 Chr1:137049370..137049443 AGTAGCGTTCCCACATGCTT Chr1:137049424..137049443 59.76 50
downstream ENSMUSE00000158963 Chr1:137050753..137050846 ATTCTTGGAGGCCTCGATCT Chr1:137050804..137050823 60.18 50
downstream ENSMUSE00000158967 Chr1:137050985..137051052 GCGAGGTCTCGCTTGTTACC Chr1:137051019..137051038 62.24 60
downstream ENSMUSE00000538969 Chr1:137051290..137051360 CAGATCTCTCGGTCCTGGAT Chr1:137051325..137051344 59.21 55
downstream ENSMUSE00000241867 Chr1:137051799..137052845 TACCTGGTGGCCCTATCAAG Chr1:137052489..137052508 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGAATGTGACCATCAAGG Chr1:137049111..137049131 59.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGAATGTGACCATCAAGG Chr1:137049111..137049131 59.78 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026426