Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1788
Trapped Gene
Arid5b (ENSMUSG00000019947)
Vector Insertion
Chr 10: 67564842 - 67580998
Public Clones (sanger) (sanger) CC0777 (sanger) D098D02 (ggtc) E039H02 (ggtc)
D057A10 (ggtc) D183H06 (ggtc) D057A10 (ggtc) (ggtc) CMHD-GT_499A1-3 (cmhd)
IST10901F4 (tigm)
Private Clones OST462689 (lexicon) OST458876 (lexicon) OST436015 (lexicon) OST433412 (lexicon)
OST421892 (lexicon) OST389630 (lexicon) OST378255 (lexicon) OST316902 (lexicon)
OST235083 (lexicon) OST181086 (lexicon) OST121166 (lexicon) OST121164 (lexicon)
OST121152 (lexicon) OST121146 (lexicon) OST121122 (lexicon) OST121106 (lexicon)
OST121103 (lexicon) OST121097 (lexicon) OST121093 (lexicon) OST121086 (lexicon)
OST121071 (lexicon) OST121067 (lexicon) OST121056 (lexicon) OST121054 (lexicon)
OST121053 (lexicon) OST121050 (lexicon) OST121042 (lexicon) OST121027 (lexicon)
OST121020 (lexicon) OST121019 (lexicon) OST121003 (lexicon) OST120992 (lexicon)
OST72601 (lexicon) OST66244 (lexicon) OST65179 (lexicon) OST60049 (lexicon)
OST54532 (lexicon) OST42201 (lexicon) OST41242 (lexicon) OST40949 (lexicon)
OST40633 (lexicon) OST37943 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099321 (Chr10:67580999..67581096 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099321 (Chr10:67580999..67581096 -)
Downstram Exon
ENSMUSE00000099298 (Chr10:67564643..67564841 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666206 Chr10:67741438..67741474 No primer for this exon
upstream ENSMUSE00000393468 Chr10:67740678..67740932 No primer for this exon
upstream ENSMUSE00000289228 Chr10:67705752..67705977 No primer for this exon
upstream ENSMUSE00000099301 Chr10:67648774..67649004 No primer for this exon
upstream ENSMUSE00000099314 Chr10:67597742..67597854 No primer for this exon
upstream ENSMUSE00000099312 Chr10:67591537..67591741 No primer for this exon
upstream ENSMUSE00000099319 Chr10:67589447..67589499 No primer for this exon
upstream ENSMUSE00000099321 Chr10:67580999..67581096 No primer for this exon

*** Putative Vector Insertion (Chr 10: 67564842 - 67580998) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099298 Chr10:67564643..67564841 No primer for this exon
downstream ENSMUSE00000575802 Chr10:67558341..67561417 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCAAAGCTAAGCTGAGAAGA Chr10:67569025..67569046 60.05 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAAGCCGTGACTGGGAAA Chr10:67568934..67568954 60.61 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTTACTGCCGAGTGGCTTA Chr10:67569113..67569133 60.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTTACTGCCGAGTGGCTTA Chr10:67569113..67569133 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019947