Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17883
Trapped Gene
Nip7 (ENSMUSG00000031917)
Vector Insertion
Chr 8: 109581312 - 109581946
Public Clones not available
Private Clones OST434402 (lexicon) OST423538 (lexicon) OST292116 (lexicon) OST245657 (lexicon)
OST238295 (lexicon) OST138432 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214638 (Chr8:109581173..109581311 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACGTGTTTTGGGAAGTTT Chr8:109581229..109581248 58.93 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214638 (Chr8:109581173..109581311 +)
Downstram Exon
ENSMUSE00000214633 (Chr8:109581947..109582087 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACGTGTTTTGGGAAGTTT Chr8:109581229..109581248 58.93 45 GTCCGCCATGGAATAGACAA Chr8:109582081..109582100 60.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214634 Chr8:109580790..109580890 AGATGAGGCCCTTGACTGAA Chr8:109580833..109580852 59.8 50
upstream ENSMUSE00000214640 Chr8:109580993..109581079 CTGCACAACGACCGAGTGTA Chr8:109581051..109581070 60.93 55
upstream ENSMUSE00000214638 Chr8:109581173..109581311 GGACGTGTTTTGGGAAGTTT Chr8:109581229..109581248 58.93 45

*** Putative Vector Insertion (Chr 8: 109581312 - 109581946) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214633 Chr8:109581947..109582087 GTCCGCCATGGAATAGACAA Chr8:109582081..109582100 60.86 50
downstream ENSMUSE00000214636 Chr8:109582277..109582937 CCTGTTTTCACGCCATTTCT Chr8:109582534..109582553 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTGACAGCTCTGGATTACC Chr8:109581275..109581296 59.23 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031917