Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17927
Trapped Gene
Atp6v1a (ENSMUSG00000052459)
Vector Insertion
Chr 16: 44114856 - 44116899
Public Clones not available
Private Clones OST433452 (lexicon) OST61873 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717637 (Chr16:44116900..44116995 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTACCCAAAATCCGAGATG Chr16:44116948..44116967 59.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717637 (Chr16:44116900..44116995 -)
Downstram Exon
ENSMUSE00000432642 (Chr16:44114727..44114855 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTACCCAAAATCCGAGATG Chr16:44116948..44116967 59.53 50 TCTCACCAGCTCGTACATGG Chr16:44114784..44114803 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433259 Chr16:44139075..44139132 GGGTCCCGTCTAGGTACACTT Chr16:44139097..44139117 59.38 57.14
upstream ENSMUSE00000700143 Chr16:44139061..44139309 CTTTTCTGAAGTCGCGGAAC Chr16:44139273..44139292 59.99 50
upstream ENSMUSE00000432662 Chr16:44116900..44116995 GCTACCCAAAATCCGAGATG Chr16:44116948..44116967 59.53 50
upstream ENSMUSE00000717637 Chr16:44116900..44116995 GCTACCCAAAATCCGAGATG Chr16:44116948..44116967 59.53 50

*** Putative Vector Insertion (Chr 16: 44114856 - 44116899) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432642 Chr16:44114727..44114855 TCTCACCAGCTCGTACATGG Chr16:44114784..44114803 59.85 55
downstream ENSMUSE00000432636 Chr16:44111611..44111825 CGACCGAGAGAGGTTTACCA Chr16:44111750..44111769 60.25 55
downstream ENSMUSE00000432629 Chr16:44111208..44111345 GCGATGTAAGTCACGCTTCC Chr16:44111211..44111230 60.81 55
downstream ENSMUSE00000432623 Chr16:44109608..44109759 CTCAAGCTCCAGGACGACAT Chr16:44109717..44109736 60.41 55
downstream ENSMUSE00000432619 Chr16:44107838..44108000 AAGTCGCGGAGAACTTCTGA Chr16:44107823..44107842 60.13 50
downstream ENSMUSE00000432612 Chr16:44107048..44107156 CTACCAGCGCTGTCCTCTTC Chr16:44107077..44107096 60.16 60
downstream ENSMUSE00000432607 Chr16:44101876..44101998 GAGGTAGAGTCGGCCATCAT Chr16:44101910..44101929 59.12 55
downstream ENSMUSE00000432597 Chr16:44101678..44101792 GCCTGCTCGCTCATAGAAAG Chr16:44101712..44101731 60.26 55
downstream ENSMUSE00000432592 Chr16:44100055..44100118 ATACCCAGCGTTGCAGAAGT Chr16:44100040..44100059 59.76 50
downstream ENSMUSE00000432582 Chr16:44098840..44099043 CACGATTTCTGCCAGATCCT Chr16:44098833..44098852 60.22 50
downstream ENSMUSE00000432574 Chr16:44091284..44091378 No primer for this exon
downstream ENSMUSE00000432566 Chr16:44089019..44089190 GACAGCATCCCCACTGTCTT Chr16:44089133..44089152 60.12 55
downstream ENSMUSE00000643560 Chr16:44085758..44087629 GCTCTCTGAAGCGAGCCTTA Chr16:44086282..44086301 60 55
downstream ENSMUSE00000700146 Chr16:44085517..44087629 GCTCTCTGAAGCGAGCCTTA Chr16:44086282..44086301 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCCTGGTAAGTAATGTGC Chr16:44116885..44116905 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCCTGGTAAGTAATGTGC Chr16:44116885..44116905 59.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052459