Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17932
Trapped Gene
Mrpl33 (ENSMUSG00000029142)
Vector Insertion
Chr 5: 31916995 - 31918753
Public Clones not available
Private Clones OST433273 (lexicon) OST308839 (lexicon) OST201809 (lexicon) OST47095 (lexicon)
OST47094 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000654677 (Chr5:31916976..31916994 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000654677 (Chr5:31916976..31916994 +)
Downstram Exon
ENSMUSE00000480109 (Chr5:31918754..31918860 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAGTCGGCTTCTCTTGTGGT Chr5:31918826..31918845 59.46 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654678 Chr5:31916345..31916395 No primer for this exon
upstream ENSMUSE00000654677 Chr5:31916976..31916994 No primer for this exon

*** Putative Vector Insertion (Chr 5: 31916995 - 31918753) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480109 Chr5:31918754..31918860 GAGTCGGCTTCTCTTGTGGT Chr5:31918826..31918845 59.46 55
downstream ENSMUSE00000366519 Chr5:31924750..31925014 TCACCCTCGAGCTTCTCATT Chr5:31924852..31924871 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTATTGGCCCAGTGTTTGG Chr5:31917013..31917033 60.72 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTATTGGCCCAGTGTTTGG Chr5:31917013..31917033 60.72 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029142