Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17936
Trapped Gene
Prune (ENSMUSG00000015711)
Vector Insertion
Chr 3: 95066292 - 95067513
Public Clones not available
Private Clones OST433197 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253487 (Chr3:95067514..95067698 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253487 (Chr3:95067514..95067698 -)
Downstram Exon
ENSMUSE00000253477 (Chr3:95066133..95066291 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391391 Chr3:95085507..95085998 No primer for this exon
upstream ENSMUSE00000332225 Chr3:95072153..95072245 No primer for this exon
upstream ENSMUSE00000253496 Chr3:95069340..95069542 No primer for this exon
upstream ENSMUSE00000253487 Chr3:95067514..95067698 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95066292 - 95067513) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253477 Chr3:95066133..95066291 No primer for this exon
downstream ENSMUSE00000176370 Chr3:95063162..95063256 No primer for this exon
downstream ENSMUSE00000253465 Chr3:95061949..95062107 No primer for this exon
downstream ENSMUSE00000413523 Chr3:95057597..95059349 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGACCTTTGCCCTTATCC Chr3:95067472..95067492 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGACCTTTGCCCTTATCC Chr3:95067472..95067492 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015711