Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17937
Trapped Gene
Gstm2 (ENSMUSG00000040562)
Vector Insertion
Chr 3: 107787143 - 107787966
Public Clones not available
Private Clones OST433164 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000508853 (Chr3:107787967..107788067 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTTGGCCATGGTTTGCTAC Chr3:107787979..107787998 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000508853 (Chr3:107787967..107788067 -)
Downstram Exon
ENSMUSE00000174032 (Chr3:107787047..107787142 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTTGGCCATGGTTTGCTAC Chr3:107787979..107787998 60 50 CTGCTTGCCCAGAAACTCAG Chr3:107787046..107787065 61.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376948 Chr3:107789276..107789371 TGCTCTGGACACCAGCACTA Chr3:107789311..107789330 60.62 55
upstream ENSMUSE00000670830 Chr3:107789148..107789278 GAGTGAGAACGCTTCTGCTG Chr3:107789254..107789273 58.91 55
upstream ENSMUSE00000495891 Chr3:107788952..107789027 GCCTGCTCCTGGAATACACA Chr3:107788992..107789011 61.21 55
upstream ENSMUSE00000514974 Chr3:107788536..107788600 No primer for this exon
upstream ENSMUSE00000513431 Chr3:107788165..107788246 ACACAAGATCACCCAGAGCA Chr3:107788204..107788223 59.26 50
upstream ENSMUSE00000508853 Chr3:107787967..107788067 AGTTGGCCATGGTTTGCTAC Chr3:107787979..107787998 60 50

*** Putative Vector Insertion (Chr 3: 107787143 - 107787966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000174032 Chr3:107787047..107787142 CTGCTTGCCCAGAAACTCAG Chr3:107787046..107787065 61.1 55
downstream ENSMUSE00000506805 Chr3:107786854..107786964 CTCAAAGCGACCCATGAAGT Chr3:107786832..107786851 60.26 50
downstream ENSMUSE00000636648 Chr3:107784865..107785056 GCACGTGGTAAGAGCTAGGG Chr3:107784878..107784897 59.9 60
downstream ENSMUSE00000385864 Chr3:107784623..107785056 GCACGTGGTAAGAGCTAGGG Chr3:107784878..107784897 59.9 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGACACCCGCATACAGTT Chr3:107787993..107788013 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGACACCCGCATACAGTT Chr3:107787993..107788013 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040562