Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17938
Trapped Gene
Atg10 (ENSMUSG00000021619)
Vector Insertion
Chr 13: 91348039 - 91363543
Public Clones (ggtc) (ggtc) (ggtc) IST12366H12 (tigm) IST11541H9 (tigm) IST12586B2 (tigm)
IST14951B1 (tigm)
Private Clones OST433156 (lexicon) OST368425 (lexicon) OST348019 (lexicon) OST310053 (lexicon)
OST295340 (lexicon) OST280226 (lexicon) OST274993 (lexicon) OST249646 (lexicon)
OST246291 (lexicon) OST240700 (lexicon) OST232127 (lexicon) OST203694 (lexicon)
OST132915 (lexicon) OST128444 (lexicon) OST107394 (lexicon) OST102993 (lexicon)
OST66150 (lexicon) OST34491 (lexicon) OST33678 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454489 (Chr13:91363544..91363592 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454489 (Chr13:91363544..91363592 -)
Downstram Exon
ENSMUSE00000412805 (Chr13:91347923..91348038 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CATCGCCTATCTGCTGTGAA Chr13:91347924..91347943 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454489 Chr13:91363544..91363592 No primer for this exon

*** Putative Vector Insertion (Chr 13: 91348039 - 91363543) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412805 Chr13:91347923..91348038 CATCGCCTATCTGCTGTGAA Chr13:91347924..91347943 59.97 50
downstream ENSMUSE00000119478 Chr13:91293822..91293917 GCATGTGGTGTCAAGGTCTC Chr13:91293828..91293847 59.1 55
downstream ENSMUSE00000228963 Chr13:91180455..91180593 CTGCAGGTCTCGTCACTTCA Chr13:91180523..91180542 60.18 55
downstream ENSMUSE00000228956 Chr13:91162175..91162272 CAGCCTCGGCTTATAGCACT Chr13:91162186..91162205 59.64 55
downstream ENSMUSE00000680664 Chr13:91162097..91162114 No primer for this exon
downstream ENSMUSE00000228946 Chr13:91076898..91076995 TGGTTGCCCAAGTATTGGAT Chr13:91076950..91076969 60.19 45
downstream ENSMUSE00000381803 Chr13:91076192..91076307 CACTCCGATTGTGATGTTGC Chr13:91076187..91076206 60.12 50
downstream ENSMUSE00000341031 Chr13:91074954..91075850 AACAGAGCAGTCGTGGGTCT Chr13:91075095..91075114 59.91 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGACCCCCTCCCCCTAAT Chr13:91351488..91351508 62.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTTAGGGAAGTGTGTGTGATG Chr13:91351554..91351577 58.17 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATTAATCGCCTTGCAGCACA Chr13:91351524..91351544 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAAAATCGTGACTGGGAAAA Chr13:91351528..91351549 58.68 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021619