Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17941
Trapped Gene
Sfrs10 (ENSMUSG00000022858)
Vector Insertion
Chr 16: 22252869 - 22254480
Public Clones PST25019-NR (escells)
Private Clones OST433040 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000560944 (Chr16:22254481..22254643 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCGCTCGCATAGACGAT Chr16:22254573..22254592 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000560944 (Chr16:22254481..22254643 -)
Downstram Exon
ENSMUSE00000560941 (Chr16:22252680..22252868 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCGCTCGCATAGACGAT Chr16:22254573..22254592 59.97 50 AGACAACAGTTGGGGTCAGG Chr16:22252821..22252840 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644766 Chr16:22265814..22265994 GAGCTCCTCGCAAAAGTGTG Chr16:22265943..22265962 61.12 55
upstream ENSMUSE00000560946 Chr16:22255057..22255190 AATCTGCACGGCATACACCT Chr16:22255125..22255144 60.55 50
upstream ENSMUSE00000560944 Chr16:22254481..22254643 ATCTCGCTCGCATAGACGAT Chr16:22254573..22254592 59.97 50

*** Putative Vector Insertion (Chr 16: 22252869 - 22254480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000560941 Chr16:22252680..22252868 AGACAACAGTTGGGGTCAGG Chr16:22252821..22252840 60 55
downstream ENSMUSE00000560939 Chr16:22250938..22251053 CTAATTCGACGCCCATCAAG Chr16:22250985..22251004 60.6 50
downstream ENSMUSE00000560937 Chr16:22249123..22249206 TAACCCCGATCGTACCCTCT Chr16:22249134..22249153 60.7 55
downstream ENSMUSE00000560933 Chr16:22248509..22248568 CCCTGTCTTGAGCTGCTCTC Chr16:22248500..22248519 60.28 60
downstream ENSMUSE00000560931 Chr16:22247263..22247336 GATCGTGATCGAGAACGTGA Chr16:22247252..22247271 59.79 50
downstream ENSMUSE00000702638 Chr16:22246442..22246939 CACACAGGCTTCGATCTTCA Chr16:22246561..22246580 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGCATAATCGCCTTGCAG Chr16:22254415..22254435 60.36 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000022858