Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17943
Trapped Gene
C030046E11Rik (ENSMUSG00000038658)
Vector Insertion
Chr 19: 29662337 - 29669288
Public Clones not available
Private Clones OST432979 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000256910 (Chr19:29662198..29662336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCTTCCTGGTAGTGTCTG Chr19:29662261..29662280 59.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000256910 (Chr19:29662198..29662336 +)
Downstram Exon
ENSMUSE00000256883 (Chr19:29669289..29669405 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCTTCCTGGTAGTGTCTG Chr19:29662261..29662280 59.57 60 TTAGGGTGGCTGTCCTTCTC Chr19:29669395..29669414 59.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000388744 Chr19:29596772..29597156 No primer for this exon
upstream ENSMUSE00000333919 Chr19:29607655..29607762 AGCTGAATGGAGACCGGATA Chr19:29607723..29607742 59.65 50
upstream ENSMUSE00000692288 Chr19:29615409..29615423 No primer for this exon
upstream ENSMUSE00000257226 Chr19:29615746..29615825 No primer for this exon
upstream ENSMUSE00000545658 Chr19:29636475..29636582 TTTGCAAGCACCCATTATGA Chr19:29636562..29636581 60.07 40
upstream ENSMUSE00000692286 Chr19:29636475..29638110 TTTGCAAGCACCCATTATGA Chr19:29636562..29636581 60.07 40
upstream ENSMUSE00000257184 Chr19:29641710..29641852 TTTGCAGTCTGTGCTGGAAG Chr19:29641710..29641729 60.17 50
upstream ENSMUSE00000257162 Chr19:29641975..29642111 TGTGCCACACTTGATGGATT Chr19:29642025..29642044 59.97 45
upstream ENSMUSE00000257139 Chr19:29643832..29643923 ATACCGACTGATGGCCTTTG Chr19:29643894..29643913 59.96 50
upstream ENSMUSE00000463186 Chr19:29645236..29645324 CAACACTACAGGAGCCATGC Chr19:29645263..29645282 59.32 55
upstream ENSMUSE00000462271 Chr19:29649222..29649366 TTGGAGCCCAGCTGATATGT Chr19:29649327..29649346 60.62 50
upstream ENSMUSE00000545652 Chr19:29650344..29650392 No primer for this exon
upstream ENSMUSE00000461387 Chr19:29652073..29652225 GATTGAGACCGACCTCAGGA Chr19:29652135..29652154 60.2 55
upstream ENSMUSE00000460530 Chr19:29654255..29654458 TCAGGGAGAAGATCGCTTGT Chr19:29654278..29654297 59.95 50
upstream ENSMUSE00000467780 Chr19:29658665..29658703 No primer for this exon
upstream ENSMUSE00000256989 Chr19:29658957..29659067 CTGGCAAGTTTGGATTTGCT Chr19:29658997..29659016 60.25 45
upstream ENSMUSE00000256966 Chr19:29660271..29660360 ATGGTCCTTGCGTGTTACAA Chr19:29660319..29660338 59.05 45
upstream ENSMUSE00000256939 Chr19:29661030..29661190 TGGTGGTAGTGTTTCGAGCA Chr19:29661127..29661146 60.3 50
upstream ENSMUSE00000256910 Chr19:29662198..29662336 CCCCTTCCTGGTAGTGTCTG Chr19:29662261..29662280 59.57 60

*** Putative Vector Insertion (Chr 19: 29662337 - 29669288) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256883 Chr19:29669289..29669405 TTAGGGTGGCTGTCCTTCTC Chr19:29669395..29669414 59.28 55
downstream ENSMUSE00000256862 Chr19:29669761..29670489 CAACGCGTCTTCAAACAGAA Chr19:29670012..29670031 60.03 45
downstream ENSMUSE00000256830 Chr19:29672237..29672395 TGGAGGGGTCTCAGATTCTC Chr19:29672380..29672399 59.18 55
downstream ENSMUSE00000256794 Chr19:29672480..29672616 AACTGATGCTCCGATTCCTG Chr19:29672534..29672553 60.22 50
downstream ENSMUSE00000256704 Chr19:29674322..29674608 TGGAAGAGGCTGGGATAATG Chr19:29674575..29674594 60.03 50
downstream ENSMUSE00000256686 Chr19:29675308..29675499 GCATTTGTGGTCCAGGAGAT Chr19:29675469..29675488 59.93 50
downstream ENSMUSE00000256659 Chr19:29676763..29676940 TTTTCATCCACCATTGTCCA Chr19:29676850..29676869 59.75 40
downstream ENSMUSE00000256635 Chr19:29677082..29677270 CCGATGACAACACACCAGTC Chr19:29677141..29677160 60.01 55
downstream ENSMUSE00000383660 Chr19:29678351..29680411 GGGATAGAGGGCTGAACTCC Chr19:29680065..29680084 60.04 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAGAATGGCATCAGCTTG Chr19:29668303..29668323 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTTTTCCGAGCTCTTAG Chr19:29668345..29668365 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038658