Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1796
Trapped Gene
Snx8 (ENSMUSG00000029560)
Vector Insertion
Chr 5: 140829468 - 140831913
Public Clones CC0395 (sanger) RRU061 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000190056 (Chr5:140831914..140832035 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTGAGGACGTGCTCCTT Chr5:140831941..140831960 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000190056 (Chr5:140831914..140832035 -)
Downstram Exon
ENSMUSE00000190052 (Chr5:140829387..140829467 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTGAGGACGTGCTCCTT Chr5:140831941..140831960 60.13 55 GAACTCATCTCCCACGCACT Chr5:140829395..140829414 60.27 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367862 Chr5:140865102..140865216 No primer for this exon
upstream ENSMUSE00000190062 Chr5:140836146..140836336 GTGGAGCTCATCCCTGAGAA Chr5:140836192..140836211 60.35 55
upstream ENSMUSE00000190051 Chr5:140834011..140834128 TCGTGGTCTTCCATGAAGTG Chr5:140834072..140834091 59.68 50
upstream ENSMUSE00000190056 Chr5:140831914..140832035 TCTCTGAGGACGTGCTCCTT Chr5:140831941..140831960 60.13 55

*** Putative Vector Insertion (Chr 5: 140829468 - 140831913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000190052 Chr5:140829387..140829467 GAACTCATCTCCCACGCACT Chr5:140829395..140829414 60.27 55
downstream ENSMUSE00000190061 Chr5:140828989..140829149 GGCTCTGTCTCGAAGCTTGT Chr5:140829032..140829051 59.75 55
downstream ENSMUSE00000298718 Chr5:140828087..140828219 No primer for this exon
downstream ENSMUSE00000190059 Chr5:140822231..140822299 No primer for this exon
downstream ENSMUSE00000190057 Chr5:140820663..140820809 TTCATCAGGCCGTACTTGTG Chr5:140820714..140820733 59.72 50
downstream ENSMUSE00000190058 Chr5:140820240..140820389 GGATCTGGGAGTTCACGAAG Chr5:140820232..140820251 59.65 55
downstream ENSMUSE00000427267 Chr5:140816258..140817596 GCCCAAGGCTAGAGTCACTG Chr5:140817066..140817085 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGAAACTAATCGCCTTGC Chr5:140831850..140831870 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCTTCAGTGGCTCGGTAA Chr5:140831908..140831928 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029560