Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17962
Trapped Gene
Dppa5a (ENSMUSG00000060461)
Vector Insertion
Chr 9: 78215102 - 78215527
Public Clones IST10111A10 (tigm) IST10111A10 (tigm)
Private Clones OST432763 (lexicon) OST241011 (lexicon) OST34658 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516414 (Chr9:78215528..78215710 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCGGGCTAAATGGATGCT Chr9:78215569..78215588 60.79 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516414 (Chr9:78215528..78215710 -)
Downstram Exon
ENSMUSE00000388301 (Chr9:78214864..78215101 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCGGGCTAAATGGATGCT Chr9:78215569..78215588 60.79 45 ATCCAGGTCGGAGACACAAG Chr9:78214986..78215005 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000517407 Chr9:78215792..78215965 ATGATGGTGACCCTCGTGAC Chr9:78215887..78215906 60.82 55
upstream ENSMUSE00000516414 Chr9:78215528..78215710 ATTCGGGCTAAATGGATGCT Chr9:78215569..78215588 60.79 45

*** Putative Vector Insertion (Chr 9: 78215102 - 78215527) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000388301 Chr9:78214864..78215101 ATCCAGGTCGGAGACACAAG Chr9:78214986..78215005 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTAACAGGTGCCCTGAACC Chr9:78215497..78215517 60.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTAACAGGTGCCCTGAACC Chr9:78215497..78215517 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGGGTCTTGGAACTATGCTC Chr9:78215728..78215748 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGGGTCTTGGAACTATGCTC Chr9:78215728..78215748 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060461