Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17963
Trapped Gene
Klf3 (ENSMUSG00000029178)
Vector Insertion
Chr 5: 65218510 - 65220215
Public Clones not available
Private Clones OST432724 (lexicon) OST275488 (lexicon) OST30344 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000186625 (Chr5:65218349..65218509 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAAGCGCAGGATACACAG Chr5:65218416..65218435 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000186625 (Chr5:65218349..65218509 +)
Downstram Exon
ENSMUSE00000186622 (Chr5:65220216..65221367 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAAGCGCAGGATACACAG Chr5:65218416..65218435 60.42 55 ACCCTCTCGGTATCCAGCTT Chr5:65221268..65221287 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394739 Chr5:65194628..65195030 GTCATGTGACTGCCCAGAGTT Chr5:65194780..65194800 60.17 52.38
upstream ENSMUSE00000186617 Chr5:65207974..65208069 ATCCAGTCCCTGTCAAGCAG Chr5:65208026..65208045 60.26 55
upstream ENSMUSE00000186613 Chr5:65213113..65213596 GTCCAGCCCGTTCCTTTTAT Chr5:65213500..65213519 60.32 50
upstream ENSMUSE00000186619 Chr5:65214118..65214268 CCCCCTTTAATGAACCCAGT Chr5:65214222..65214241 60.05 50
upstream ENSMUSE00000186625 Chr5:65218349..65218509 AGGAAGCGCAGGATACACAG Chr5:65218416..65218435 60.42 55

*** Putative Vector Insertion (Chr 5: 65218510 - 65220215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000186622 Chr5:65220216..65221367 ACCCTCTCGGTATCCAGCTT Chr5:65221268..65221287 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATACAGGTAGGGCACGCATC Chr5:65218505..65218525 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATACAGGTAGGGCACGCATC Chr5:65218505..65218525 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029178