Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17971
Trapped Gene
Ncor1 (ENSMUSG00000018501)
Vector Insertion
Chr 11: 62247064 - 62247202
Public Clones not available
Private Clones OST432667 (lexicon) OST393129 (lexicon) OST323175 (lexicon) OST304360 (lexicon)
OST266223 (lexicon) OST262165 (lexicon) OST260641 (lexicon) OST258336 (lexicon)
OST251954 (lexicon) OST247956 (lexicon) OST218767 (lexicon) OST217060 (lexicon)
OST201872 (lexicon) OST190416 (lexicon) OST181903 (lexicon) OST179387 (lexicon)
OST175146 (lexicon) OST151465 (lexicon) OST129899 (lexicon) OST126112 (lexicon)
OST116576 (lexicon) OST104771 (lexicon) OST94283 (lexicon) OST90498 (lexicon)
OST53825 (lexicon) OST45305 (lexicon) OST45252 (lexicon) OST35086 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677727 (Chr11:62247065..62247201 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677727 (Chr11:62247065..62247201 -)
Downstram Exon
ENSMUSE00000340453 (Chr11:62247065..62247201 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431150 Chr11:62270650..62270825 No primer for this exon
upstream ENSMUSE00000589511 Chr11:62270650..62270834 No primer for this exon
upstream ENSMUSE00000677730 Chr11:62251840..62251990 No primer for this exon
upstream ENSMUSE00000718450 Chr11:62251840..62252017 No primer for this exon
upstream ENSMUSE00000718970 Chr11:62251840..62252017 No primer for this exon
upstream ENSMUSE00000722010 Chr11:62251840..62252017 No primer for this exon
upstream ENSMUSE00000340453 Chr11:62247065..62247201 No primer for this exon
upstream ENSMUSE00000677727 Chr11:62247065..62247201 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62247064 - 62247202) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000390976 Chr11:62236377..62236569 No primer for this exon
downstream ENSMUSE00000677726 Chr11:62236377..62236569 No primer for this exon
downstream ENSMUSE00000237832 Chr11:62233100..62233282 No primer for this exon
downstream ENSMUSE00000677725 Chr11:62233100..62233282 No primer for this exon
downstream ENSMUSE00000503097 Chr11:62224322..62224435 No primer for this exon
downstream ENSMUSE00000677724 Chr11:62224322..62224435 No primer for this exon
downstream ENSMUSE00000105668 Chr11:62217912..62217968 No primer for this exon
downstream ENSMUSE00000677723 Chr11:62217912..62217968 No primer for this exon
downstream ENSMUSE00000105674 Chr11:62217301..62217353 No primer for this exon
downstream ENSMUSE00000677722 Chr11:62217301..62217353 No primer for this exon
downstream ENSMUSE00000652363 Chr11:62216938..62216964 No primer for this exon
downstream ENSMUSE00000589508 Chr11:62214885..62216964 No primer for this exon
downstream ENSMUSE00000398038 Chr11:62214703..62214769 No primer for this exon
downstream ENSMUSE00000677721 Chr11:62214703..62214769 No primer for this exon
downstream ENSMUSE00000105712 Chr11:62211767..62211939 No primer for this exon
downstream ENSMUSE00000677720 Chr11:62211767..62211939 No primer for this exon
downstream ENSMUSE00000376902 Chr11:62208640..62208730 No primer for this exon
downstream ENSMUSE00000652370 Chr11:62208640..62208730 No primer for this exon
downstream ENSMUSE00000105713 Chr11:62206007..62206185 No primer for this exon
downstream ENSMUSE00000710255 Chr11:62206007..62206185 No primer for this exon
downstream ENSMUSE00000716019 Chr11:62206007..62206185 No primer for this exon
downstream ENSMUSE00000411290 Chr11:62204481..62204535 No primer for this exon
downstream ENSMUSE00000677718 Chr11:62204481..62204535 No primer for this exon
downstream ENSMUSE00000105683 Chr11:62203193..62203294 No primer for this exon
downstream ENSMUSE00000677717 Chr11:62203193..62203294 No primer for this exon
downstream ENSMUSE00000652359 Chr11:62198220..62198344 No primer for this exon
downstream ENSMUSE00000708339 Chr11:62198220..62198344 No primer for this exon
downstream ENSMUSE00000717987 Chr11:62198220..62198344 No primer for this exon
downstream ENSMUSE00000431066 Chr11:62196663..62196877 No primer for this exon
downstream ENSMUSE00000677716 Chr11:62196663..62196877 No primer for this exon
downstream ENSMUSE00000431059 Chr11:62194910..62194972 No primer for this exon
downstream ENSMUSE00000677715 Chr11:62194910..62194972 No primer for this exon
downstream ENSMUSE00000431053 Chr11:62192017..62192156 No primer for this exon
downstream ENSMUSE00000652380 Chr11:62191999..62192156 No primer for this exon
downstream ENSMUSE00000677714 Chr11:62191999..62192156 No primer for this exon
downstream ENSMUSE00000431046 Chr11:62190137..62190263 No primer for this exon
downstream ENSMUSE00000677713 Chr11:62190137..62190263 No primer for this exon
downstream ENSMUSE00000431184 Chr11:62186578..62187124 No primer for this exon
downstream ENSMUSE00000652368 Chr11:62186578..62187076 No primer for this exon
downstream ENSMUSE00000652378 Chr11:62186578..62187124 No primer for this exon
downstream ENSMUSE00000431039 Chr11:62182796..62182925 No primer for this exon
downstream ENSMUSE00000677712 Chr11:62182796..62182925 No primer for this exon
downstream ENSMUSE00000431033 Chr11:62180466..62180661 No primer for this exon
downstream ENSMUSE00000677711 Chr11:62180466..62180661 No primer for this exon
downstream ENSMUSE00000677692 Chr11:62180446..62180661 No primer for this exon
downstream ENSMUSE00000589510 Chr11:62173263..62173436 No primer for this exon
downstream ENSMUSE00000677728 Chr11:62173263..62173293 No primer for this exon
downstream ENSMUSE00000399402 Chr11:62172357..62172517 No primer for this exon
downstream ENSMUSE00000720590 Chr11:62172357..62172517 No primer for this exon
downstream ENSMUSE00000720734 Chr11:62172357..62172517 No primer for this exon
downstream ENSMUSE00000105699 Chr11:62168073..62168190 No primer for this exon
downstream ENSMUSE00000677690 Chr11:62168073..62168190 No primer for this exon
downstream ENSMUSE00000652377 Chr11:62167885..62167974 No primer for this exon
downstream ENSMUSE00000105665 Chr11:62167873..62167974 No primer for this exon
downstream ENSMUSE00000105662 Chr11:62166736..62166836 No primer for this exon
downstream ENSMUSE00000677689 Chr11:62166736..62166836 No primer for this exon
downstream ENSMUSE00000105663 Chr11:62164880..62165048 No primer for this exon
downstream ENSMUSE00000677688 Chr11:62164880..62165048 No primer for this exon
downstream ENSMUSE00000652376 Chr11:62162897..62162995 No primer for this exon
downstream ENSMUSE00000431006 Chr11:62162855..62162995 No primer for this exon
downstream ENSMUSE00000105703 Chr11:62158737..62158820 No primer for this exon
downstream ENSMUSE00000677687 Chr11:62158737..62158820 No primer for this exon
downstream ENSMUSE00000677686 Chr11:62158134..62158390 No primer for this exon
downstream ENSMUSE00000718524 Chr11:62158134..62158390 No primer for this exon
downstream ENSMUSE00000721941 Chr11:62158134..62158390 No primer for this exon
downstream ENSMUSE00000105695 Chr11:62156499..62156853 No primer for this exon
downstream ENSMUSE00000677708 Chr11:62156499..62156853 No primer for this exon
downstream ENSMUSE00000105723 Chr11:62153910..62154131 No primer for this exon
downstream ENSMUSE00000677707 Chr11:62153910..62154131 No primer for this exon
downstream ENSMUSE00000237625 Chr11:62152361..62152567 No primer for this exon
downstream ENSMUSE00000467726 Chr11:62152361..62152570 No primer for this exon
downstream ENSMUSE00000677706 Chr11:62152361..62152570 No primer for this exon
downstream ENSMUSE00000105715 Chr11:62151601..62151750 No primer for this exon
downstream ENSMUSE00000677705 Chr11:62151601..62151750 No primer for this exon
downstream ENSMUSE00000237610 Chr11:62151047..62151196 No primer for this exon
downstream ENSMUSE00000677704 Chr11:62151047..62151196 No primer for this exon
downstream ENSMUSE00000237603 Chr11:62147998..62148163 No primer for this exon
downstream ENSMUSE00000677703 Chr11:62147998..62148163 No primer for this exon
downstream ENSMUSE00000677729 Chr11:62147522..62147658 No primer for this exon
downstream ENSMUSE00000105691 Chr11:62147165..62147658 No primer for this exon
downstream ENSMUSE00000677702 Chr11:62147165..62147658 No primer for this exon
downstream ENSMUSE00000105710 Chr11:62144298..62144426 No primer for this exon
downstream ENSMUSE00000677701 Chr11:62144298..62144426 No primer for this exon
downstream ENSMUSE00000105698 Chr11:62143478..62143641 No primer for this exon
downstream ENSMUSE00000677700 Chr11:62143478..62143641 No primer for this exon
downstream ENSMUSE00000105673 Chr11:62142943..62143154 No primer for this exon
downstream ENSMUSE00000677699 Chr11:62142943..62143154 No primer for this exon
downstream ENSMUSE00000105686 Chr11:62140608..62140751 No primer for this exon
downstream ENSMUSE00000589509 Chr11:62140608..62140748 No primer for this exon
downstream ENSMUSE00000677698 Chr11:62140608..62140751 No primer for this exon
downstream ENSMUSE00000105692 Chr11:62138989..62139131 No primer for this exon
downstream ENSMUSE00000677697 Chr11:62138989..62139131 No primer for this exon
downstream ENSMUSE00000105676 Chr11:62134894..62134947 No primer for this exon
downstream ENSMUSE00000677696 Chr11:62134894..62134947 No primer for this exon
downstream ENSMUSE00000105716 Chr11:62134498..62134719 No primer for this exon
downstream ENSMUSE00000677695 Chr11:62134498..62134719 No primer for this exon
downstream ENSMUSE00000105660 Chr11:62132868..62133044 No primer for this exon
downstream ENSMUSE00000677694 Chr11:62132868..62133044 No primer for this exon
downstream ENSMUSE00000519699 Chr11:62131338..62131532 No primer for this exon
downstream ENSMUSE00000430535 Chr11:62130192..62131532 No primer for this exon
downstream ENSMUSE00000677693 Chr11:62130192..62131532 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGACTACCGCTCTTCTCA Chr11:62247168..62247189 60.14 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGACTACCGCTCTTCTCA Chr11:62247168..62247189 60.14 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018501