Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17981
Trapped Gene
2810432D09Rik (ENSMUSG00000036114)
Vector Insertion
Chr 4: 41659847 - 41660492
Public Clones (sanger) IST13602G3 (tigm) IST14113A9 (tigm)
Private Clones OST432505 (lexicon) OST353102 (lexicon) OST301180 (lexicon) OST239467 (lexicon)
OST191562 (lexicon) OST112542 (lexicon) OST61320 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000415944 (Chr4:41660493..41660544 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGGGTCGAGCGTCTACT Chr4:41660503..41660522 59.48 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000415944 (Chr4:41660493..41660544 -)
Downstram Exon
ENSMUSE00000410166 (Chr4:41659065..41659846 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGGGTCGAGCGTCTACT Chr4:41660503..41660522 59.48 60 GACCCACGCCAGTCTTTTTA Chr4:41659147..41659166 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000415944 Chr4:41660493..41660544 GTGAGGGTCGAGCGTCTACT Chr4:41660503..41660522 59.48 60

*** Putative Vector Insertion (Chr 4: 41659847 - 41660492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410166 Chr4:41659065..41659846 GACCCACGCCAGTCTTTTTA Chr4:41659147..41659166 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTACTGGCGACCGTGGTAAG Chr4:41660486..41660506 60.7 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACTGGCGACCGTGGTAAG Chr4:41660486..41660506 60.7 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036114