Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17985
Trapped Gene
Setd8 (ENSMUSG00000049327)
Vector Insertion
Chr 5: 124896094 - 124897222
Public Clones E123E10 (ggtc) D184G08 (ggtc) E123E10 (ggtc) D184G08 (ggtc) CMHD-GT_483A8-3 (cmhd)
CMHD-GT_475G12-3 (cmhd) CMHD-GT_524A4-3 (cmhd) CMHD-GT_495G7-3 (cmhd) CMHD-GT_407B2-3 (cmhd)
(cmhd) CMHD-GT_524B6-3 (cmhd) CMHD-GT_493H11-3 (cmhd) CMHD-GT_509H8-3 (cmhd)
Private Clones OST432450 (lexicon) OST419800 (lexicon) OST379254 (lexicon) OST319488 (lexicon)
OST301678 (lexicon) OST288251 (lexicon) OST280585 (lexicon) OST268906 (lexicon)
OST268329 (lexicon) OST240062 (lexicon) OST238482 (lexicon) OST205362 (lexicon)
OST68796 (lexicon) OST60824 (lexicon) OST56810 (lexicon) OST54547 (lexicon)
OST40086 (lexicon) OST36714 (lexicon) OST33480 (lexicon) OST1973 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398617 (Chr5:124895978..124896093 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398617 (Chr5:124895978..124896093 +)
Downstram Exon
ENSMUSE00000384855 (Chr5:124897223..124897379 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAACCGAGTTCTCTTCCTG Chr5:124897323..124897342 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426884 Chr5:124889939..124890024 No primer for this exon
upstream ENSMUSE00000687910 Chr5:124895502..124895737 No primer for this exon
upstream ENSMUSE00000649613 Chr5:124895548..124895583 No primer for this exon
upstream ENSMUSE00000649612 Chr5:124895586..124895672 No primer for this exon
upstream ENSMUSE00000649611 Chr5:124895675..124895737 No primer for this exon
upstream ENSMUSE00000398617 Chr5:124895978..124896093 No primer for this exon

*** Putative Vector Insertion (Chr 5: 124896094 - 124897222) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000384855 Chr5:124897223..124897379 GCAACCGAGTTCTCTTCCTG Chr5:124897323..124897342 59.99 55
downstream ENSMUSE00000322583 Chr5:124900670..124900889 TTCTGCTGCTTCGGATTTTT Chr5:124900791..124900810 59.96 40
downstream ENSMUSE00000322577 Chr5:124901295..124901382 CTCCGCACAGGGTAGAAATC Chr5:124901354..124901373 59.69 55
downstream ENSMUSE00000322573 Chr5:124907068..124907127 CTTCCTTCCCGCTCTCAATC Chr5:124907119..124907138 61.23 55
downstream ENSMUSE00000322569 Chr5:124909784..124909974 ACTGCTTGGTAGCGATCACA Chr5:124909835..124909854 59.47 50
downstream ENSMUSE00000687911 Chr5:124910496..124910550 CTAGGCGGTTCGTTTCTTGA Chr5:124910531..124910550 60.38 50
downstream ENSMUSE00000351091 Chr5:124910497..124912316 CTTCGGTCCCCATAGTCGTA Chr5:124910670..124910689 59.95 55
downstream ENSMUSE00000649608 Chr5:124910497..124910892 GTGTGTGTGTGTGCGTGTGT Chr5:124910816..124910835 60.18 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr5:124896144..124896165 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000049327