Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI17995
Trapped Gene
Prkci (ENSMUSG00000037643)
Vector Insertion
Chr 3: 30940452 - 30942612
Public Clones not available
Private Clones OST432391 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000273399 (Chr3:30940364..30940451 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACAACCAGCACTTTCTGC Chr3:30940383..30940402 58.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000273399 (Chr3:30940364..30940451 +)
Downstram Exon
ENSMUSE00000273390 (Chr3:30942613..30942738 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACAACCAGCACTTTCTGC Chr3:30940383..30940402 58.94 50 GCTCCCAACGATATCAAACG Chr3:30942698..30942717 60.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445045 Chr3:30894669..30895007 GTCCGGGTGAAAGCCTACTAC Chr3:30894982..30895002 60.01 57.14
upstream ENSMUSE00000273499 Chr3:30917472..30917593 CCGTTCACCATGAAATGGAT Chr3:30917563..30917582 60.58 45
upstream ENSMUSE00000273487 Chr3:30924052..30924141 GCTGTACGAGCTGAACAAGG Chr3:30924101..30924120 58.68 55
upstream ENSMUSE00000273474 Chr3:30925175..30925225 TACCAGAGCGTCCTGGAATG Chr3:30925187..30925206 61.2 55
upstream ENSMUSE00000273464 Chr3:30928408..30928493 TTTCAAGCCAAACGTTTCAA Chr3:30928470..30928489 59.32 35
upstream ENSMUSE00000273454 Chr3:30930006..30930146 CCTCGGACGACAAGGATACA Chr3:30930044..30930063 61.06 55
upstream ENSMUSE00000273444 Chr3:30932100..30932151 AGACCATGCATCCAGACCAC Chr3:30932122..30932141 60.97 55
upstream ENSMUSE00000273437 Chr3:30933421..30933479 CCAAGTTGGTGAAGAAAAGGA Chr3:30933458..30933478 59.2 42.86
upstream ENSMUSE00000273428 Chr3:30936768..30936944 AGGGGAAGTTACGCCAAAGT Chr3:30936846..30936865 60 50
upstream ENSMUSE00000569053 Chr3:30937372..30937469 TATCGATTGGGTGCAGACAG Chr3:30937374..30937393 59.67 50
upstream ENSMUSE00000569052 Chr3:30937951..30938037 TGTAAATGGAGGGGACCTCA Chr3:30937972..30937991 60.31 50
upstream ENSMUSE00000273403 Chr3:30938290..30938425 No primer for this exon
upstream ENSMUSE00000273399 Chr3:30940364..30940451 ACACAACCAGCACTTTCTGC Chr3:30940383..30940402 58.94 50

*** Putative Vector Insertion (Chr 3: 30940452 - 30942612) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000273390 Chr3:30942613..30942738 GCTCCCAACGATATCAAACG Chr3:30942698..30942717 60.47 50
downstream ENSMUSE00000273384 Chr3:30943804..30943883 No primer for this exon
downstream ENSMUSE00000273378 Chr3:30945395..30945484 ACAACCCAATCGTTCCTTTG Chr3:30945421..30945440 59.83 45
downstream ENSMUSE00000273376 Chr3:30945894..30946009 GGAGTGAGCTGGACTGGTTC Chr3:30946003..30946022 59.84 60
downstream ENSMUSE00000444307 Chr3:30949112..30951659 TAGCAGCTTAGGGCGTGAAT Chr3:30950855..30950874 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCAACTAATCGCCTTGCAG Chr3:30940497..30940517 60.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCAACCGTGACTGGGAAA Chr3:30940496..30940516 61.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037643