Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18001
Trapped Gene
Pdap1 (ENSMUSG00000029623)
Vector Insertion
Chr 5: 145897863 - 145900835
Public Clones 5SE067E07 (ggtc) 3SP131A05 (ggtc) 5SD051E08 (ggtc) 5SE044B07 (ggtc)
(ggtc) 3SD051E08 (ggtc) 5SP131A05 (ggtc)
Private Clones OST432339 (lexicon) OST237044 (lexicon) OST172748 (lexicon) OST164830 (lexicon)
OST162781 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684841 (Chr5:145900836..145900888 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCGAGATGCCTAAAGGAG Chr5:145900836..145900855 60.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684841 (Chr5:145900836..145900888 -)
Downstram Exon
ENSMUSE00000407837 (Chr5:145897771..145897862 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCGAGATGCCTAAAGGAG Chr5:145900836..145900855 60.86 55 GGGCTCGTATACTGCCTCAC Chr5:145897795..145897814 59.72 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684841 Chr5:145900836..145900888 AGCCGAGATGCCTAAAGGAG Chr5:145900836..145900855 60.86 55

*** Putative Vector Insertion (Chr 5: 145897863 - 145900835) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000407837 Chr5:145897771..145897862 GGGCTCGTATACTGCCTCAC Chr5:145897795..145897814 59.72 60
downstream ENSMUSE00000190824 Chr5:145895934..145896041 CCCCATCTCCACCTTCTTCT Chr5:145895986..145896005 60.45 55
downstream ENSMUSE00000190823 Chr5:145893728..145893849 AGATCCAGTTGCGTGACCTT Chr5:145893739..145893758 59.73 50
downstream ENSMUSE00000190822 Chr5:145892234..145892385 CTCTGTCTTCCCAGCCAAAT Chr5:145892297..145892316 59.28 50
downstream ENSMUSE00000361483 Chr5:145890526..145891244 GCGTGCAATCTACTGGACAA Chr5:145890822..145890841 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGTGCAGTAATCGCCTTG Chr5:145897850..145897870 59.87 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCGCGTGGCTTCTCTAGT Chr5:145897793..145897814 63.04 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGGAAGAAGTCGATTCCAAG Chr5:145897910..145897930 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGACAGCCTTTTGGGAGTC Chr5:145897917..145897937 60.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029623