Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18009
Trapped Gene
Dnmt3b (ENSMUSG00000027478)
Vector Insertion
Chr 2: 153487160 - 153487339
Public Clones not available
Private Clones OST432180 (lexicon) OST222861 (lexicon) OST172872 (lexicon) OST145902 (lexicon)
OST63166 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719289 (Chr2:153487161..153487338 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCACACCAGAGACCAGAG Chr2:153487319..153487338 59.6 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719289 (Chr2:153487161..153487338 +)
Downstram Exon
ENSMUSE00000464477 (Chr2:153487161..153487338 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCACACCAGAGACCAGAG Chr2:153487319..153487338 59.6 60 AGCATCCTTCGTGTCTGAGG Chr2:153487280..153487299 60.41 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681540 Chr2:153475186..153475476 GTTAAGCGGCCCAAGTAAAC Chr2:153475347..153475366 58.77 50
upstream ENSMUSE00000661408 Chr2:153475189..153475476 GTTAAGCGGCCCAAGTAAAC Chr2:153475347..153475366 58.77 50
upstream ENSMUSE00000470093 Chr2:153475190..153475476 GTTAAGCGGCCCAAGTAAAC Chr2:153475347..153475366 58.77 50
upstream ENSMUSE00000681534 Chr2:153475353..153475476 No primer for this exon
upstream ENSMUSE00000471232 Chr2:153476521..153476635 AATCCAGGGCCTTCTTTCAG Chr2:153476616..153476635 60.57 50

*** Putative Vector Insertion (Chr 2: 153487160 - 153487339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464477 Chr2:153487161..153487338 AGCATCCTTCGTGTCTGAGG Chr2:153487280..153487299 60.41 55
downstream ENSMUSE00000719289 Chr2:153487161..153487338 AGCATCCTTCGTGTCTGAGG Chr2:153487280..153487299 60.41 55
downstream ENSMUSE00000465132 Chr2:153487879..153487940 TCTTAGACAGCCGGGAGCTT Chr2:153487911..153487930 61.41 55
downstream ENSMUSE00000466022 Chr2:153488450..153488569 GGGTGAGCTTTGGCATTAGA Chr2:153488531..153488550 60.21 50
downstream ENSMUSE00000169921 Chr2:153490988..153491113 GAGGTCCCATTGCTATGTCG Chr2:153491019..153491038 60.48 55
downstream ENSMUSE00000169932 Chr2:153491643..153491837 CCATACCCTCCTGATCTCCA Chr2:153491787..153491806 59.88 55
downstream ENSMUSE00000169920 Chr2:153493240..153493398 GCCATCACCAAACCACTGTA Chr2:153493389..153493408 59.42 50
downstream ENSMUSE00000169931 Chr2:153495484..153495591 AGAGCCACCAGTTTGTCAGC Chr2:153495512..153495531 60.45 55
downstream ENSMUSE00000169940 Chr2:153496039..153496183 TGGTCCTCCAGTGACTCTCC Chr2:153496103..153496122 60.24 60
downstream ENSMUSE00000169930 Chr2:153496585..153496644 ACGACGCACCTTCGACTTAT Chr2:153496613..153496632 59.76 50
downstream ENSMUSE00000169939 Chr2:153497952..153498071 TCCCGCCATAGCTATTTGTC Chr2:153498044..153498063 60.06 50
downstream ENSMUSE00000169929 Chr2:153498232..153498276 TTCCAGATTGCCCTTGTTGT Chr2:153498278..153498297 60.49 45
downstream ENSMUSE00000169928 Chr2:153499723..153499802 GGACACAGGGTTCTTCTTTCC Chr2:153499762..153499782 59.97 52.38
downstream ENSMUSE00000169926 Chr2:153500085..153500197 GGACTGATAGCCGTCCTCAT Chr2:153500138..153500157 59.12 55
downstream ENSMUSE00000169938 Chr2:153500594..153500780 AGCACCTCCAGACACTCCAC Chr2:153500626..153500645 60.31 60
downstream ENSMUSE00000639876 Chr2:153501462..153501549 CGTTGCAATTCCATCAAACA Chr2:153501551..153501570 60.5 40
downstream ENSMUSE00000169941 Chr2:153501465..153501549 CGTTGCAATTCCATCAAACA Chr2:153501551..153501570 60.5 40
downstream ENSMUSE00000169925 Chr2:153502432..153502577 GTGATTTTCCGGACGTCATT Chr2:153502570..153502589 59.8 45
downstream ENSMUSE00000169936 Chr2:153502907..153502997 GGGCAGGATTGACGTTAGAG Chr2:153502985..153503004 59.69 55
downstream ENSMUSE00000169933 Chr2:153503247..153503395 GGCGGGTATAATTCAGCAAG Chr2:153503303..153503322 59.57 50
downstream ENSMUSE00000555577 Chr2:153504207..153504292 GTGAGCAGCAGACACCTTGA Chr2:153504254..153504273 60.19 55
downstream ENSMUSE00000275931 Chr2:153509344..153509413 ACTGAACTCCAGGCAGTCCT Chr2:153509404..153509423 58.9 55
downstream ENSMUSE00000555572 Chr2:153510095..153510213 TGATGGAGTTCGACTTGGTG Chr2:153510140..153510159 59.68 50
downstream ENSMUSE00000513883 Chr2:153511994..153513462 CCTCCTTCGTATCCCTCACA Chr2:153512931..153512950 60.06 55
downstream ENSMUSE00000619866 Chr2:153511994..153513466 CCTCCTTCGTATCCCTCACA Chr2:153512931..153512950 60.06 55
downstream ENSMUSE00000681533 Chr2:153511994..153513052 CCTCCTTCGTATCCCTCACA Chr2:153512931..153512950 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCACAGGAAACAATGAAG Chr2:153487154..153487174 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCACAGGAAACAATGAAG Chr2:153487154..153487174 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027478