Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1801
Trapped Gene
Mapk1ip1 (ENSMUSG00000041775)
Vector Insertion
Chr 7: 146032618 - 146037639
Public Clones (sanger) CC0348 (sanger) IST14975A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710036 (Chr7:146037640..146037940 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710036 (Chr7:146037640..146037940 -)
Downstram Exon
ENSMUSE00000716184 (Chr7:146032260..146032617 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55 CATTGAGTTGCTTCCCCTGT Chr7:146032550..146032569 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000470206 Chr7:146037640..146037943 CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55
upstream ENSMUSE00000710036 Chr7:146037640..146037940 CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55
upstream ENSMUSE00000719338 Chr7:146037640..146037956 CGACGCCCTCTACGTTCTTA Chr7:146037812..146037831 60.4 55

*** Putative Vector Insertion (Chr 7: 146032618 - 146037639) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000716184 Chr7:146032260..146032617 CATTGAGTTGCTTCCCCTGT Chr7:146032550..146032569 60.11 50
downstream ENSMUSE00000714995 Chr7:146027561..146028609 AGGACCAACTGGATCTGTGG Chr7:146028154..146028173 59.96 55
downstream ENSMUSE00000468144 Chr7:146027531..146028713 AGGACCAACTGGATCTGTGG Chr7:146028154..146028173 59.96 55
downstream ENSMUSE00000711209 Chr7:146027506..146028713 AGGACCAACTGGATCTGTGG Chr7:146028154..146028173 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGATCCTCAAGTCCTGGTG Chr7:146037615..146037635 59.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGATCCTCAAGTCCTGGTG Chr7:146037615..146037635 59.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCTTTAATCGCCTTGCAG Chr7:146034876..146034896 60.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCTTCGTGACTGGGAAAAC Chr7:146037875..146037895 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041775