Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1802
Trapped Gene
Ccdc104 (ENSMUSG00000020462)
Vector Insertion
Chr 11: 29144161 - 29145085
Public Clones CC0336 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104985 (Chr11:29145086..29145150 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104985 (Chr11:29145086..29145150 -)
Downstram Exon
ENSMUSE00000104992 (Chr11:29144059..29144160 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375195 Chr11:29147015..29147306 No primer for this exon
upstream ENSMUSE00000580662 Chr11:29146516..29146597 No primer for this exon
upstream ENSMUSE00000104985 Chr11:29145086..29145150 No primer for this exon

*** Putative Vector Insertion (Chr 11: 29144161 - 29145085) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104992 Chr11:29144059..29144160 No primer for this exon
downstream ENSMUSE00000104987 Chr11:29134358..29134472 No primer for this exon
downstream ENSMUSE00000708530 Chr11:29130586..29130673 No primer for this exon
downstream ENSMUSE00000721744 Chr11:29130586..29130673 No primer for this exon
downstream ENSMUSE00000104988 Chr11:29129908..29129959 No primer for this exon
downstream ENSMUSE00000593249 Chr11:29129908..29129959 No primer for this exon
downstream ENSMUSE00000104982 Chr11:29125857..29125959 No primer for this exon
downstream ENSMUSE00000593248 Chr11:29125857..29125959 No primer for this exon
downstream ENSMUSE00000104989 Chr11:29122744..29122883 No primer for this exon
downstream ENSMUSE00000593247 Chr11:29122744..29122883 No primer for this exon
downstream ENSMUSE00000104979 Chr11:29122434..29122583 No primer for this exon
downstream ENSMUSE00000593246 Chr11:29122434..29122583 No primer for this exon
downstream ENSMUSE00000342812 Chr11:29121547..29121985 No primer for this exon
downstream ENSMUSE00000593245 Chr11:29121547..29121985 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGTGAGTATTTCCCCCTGA Chr11:29145066..29145087 61.24 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGTGAGTATTTCCCCCTGA Chr11:29145066..29145087 61.24 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020462