Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18033
Trapped Gene
Dnalc4 (ENSMUSG00000022420)
Vector Insertion
Chr 15: 79595452 - 79604788
Public Clones D109E11 (ggtc) D109E11 (ggtc) IST14640C1 (tigm)
Private Clones OST431636 (lexicon) OST91617 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000126368 (Chr15:79604789..79604887 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCGTGATGGTTGCTAAGA Chr15:79604865..79604884 59.27 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000126368 (Chr15:79604789..79604887 -)
Downstram Exon
ENSMUSE00000259610 (Chr15:79595246..79595451 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCGTGATGGTTGCTAAGA Chr15:79604865..79604884 59.27 45 CCCTTCAGTCTCTCCCATGA Chr15:79595275..79595294 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000126368 Chr15:79604789..79604887 TTCCGTGATGGTTGCTAAGA Chr15:79604865..79604884 59.27 45

*** Putative Vector Insertion (Chr 15: 79595452 - 79604788) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000259610 Chr15:79595246..79595451 CCCTTCAGTCTCTCCCATGA Chr15:79595275..79595294 60.19 55
downstream ENSMUSE00000126372 Chr15:79593940..79594023 TGACACACAGCTCCATGGTC Chr15:79593950..79593969 60.76 55
downstream ENSMUSE00000431373 Chr15:79592857..79592955 CTCGTGGGTGATCTCAAACC Chr15:79592835..79592854 60.51 55
downstream ENSMUSE00000431366 Chr15:79592312..79592479 TGATTCCACATGGCCACTAA Chr15:79592384..79592403 59.92 45
downstream ENSMUSE00000126374 Chr15:79591893..79592955 TGATTCCACATGGCCACTAA Chr15:79592384..79592403 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGATAATCGCCTTGCAG Chr15:79604723..79604743 62.91 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGACGTGACTGGGAAAA Chr15:79604723..79604743 63.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGCTGCTGATCCTTCCTGT Chr15:79604842..79604862 60.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAGGTCGTGACTGGGAAAAC Chr15:79604822..79604842 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022420