Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18053
Trapped Gene
Arrdc3 (ENSMUSG00000074794)
Vector Insertion
Chr 13: 81030904 - 81032630
Public Clones not available
Private Clones OST431278 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641025 (Chr13:81030749..81030903 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCAGGAGTTTCGGTTCCT Chr13:81030862..81030881 59.94 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641025 (Chr13:81030749..81030903 +)
Downstram Exon
ENSMUSE00000641024 (Chr13:81032631..81035290 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCAGGAGTTTCGGTTCCT Chr13:81030862..81030881 59.94 50 ATGGTAGTGAGTGCCCAAGG Chr13:81034865..81034884 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641035 Chr13:81022671..81023190 GATCCTGCCTGCATGATTTT Chr13:81022778..81022797 60.04 45
upstream ENSMUSE00000641034 Chr13:81026667..81026748 GCATTTAGCTTCGAGCTTCC Chr13:81026723..81026742 59.21 50
upstream ENSMUSE00000641033 Chr13:81028350..81028497 CTATTGGGTGAAAGCCGAAT Chr13:81028392..81028411 59.04 45
upstream ENSMUSE00000641029 Chr13:81029357..81029459 GGCCCCATATCCTTAAGTGC Chr13:81029411..81029430 60.66 55
upstream ENSMUSE00000641028 Chr13:81029795..81030051 CGTGGCGAGTCTTTATCCTC Chr13:81029932..81029951 59.84 55
upstream ENSMUSE00000641027 Chr13:81030323..81030485 CCGTTTGGTAGCAGAACCTC Chr13:81030398..81030417 59.73 55
upstream ENSMUSE00000641025 Chr13:81030749..81030903 ATCCAGGAGTTTCGGTTCCT Chr13:81030862..81030881 59.94 50

*** Putative Vector Insertion (Chr 13: 81030904 - 81032630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641024 Chr13:81032631..81035290 ATGGTAGTGAGTGCCCAAGG Chr13:81034865..81034884 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGAGGAAGCAGCAGTAAT Chr13:81030939..81030959 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGAGTCTCCGAGGAAGCA Chr13:81030931..81030951 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074794