Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18056
Trapped Gene
2410018C20Rik (ENSMUSG00000004996)
Vector Insertion
Chr 8: 86778252 - 86780142
Public Clones not available
Private Clones OST431195 (lexicon) OST383592 (lexicon) OST125494 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212093 (Chr8:86780143..86780318 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212093 (Chr8:86780143..86780318 -)
Downstram Exon
ENSMUSE00000331915 (Chr8:86778075..86778251 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000212095 Chr8:86780789..86781191 No primer for this exon
upstream ENSMUSE00000212093 Chr8:86780143..86780318 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86778252 - 86780142) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331915 Chr8:86778075..86778251 No primer for this exon
downstream ENSMUSE00000377599 Chr8:86777762..86777986 No primer for this exon
downstream ENSMUSE00000212096 Chr8:86775386..86775610 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTGTTAGGGCATGGGACA Chr8:86780105..86780125 60.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGTTAGGGCATGGGACA Chr8:86780105..86780125 60.19 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004996