Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1806
Trapped Gene
Zfp35 (ENSMUSG00000063281)
Vector Insertion
Chr 18: 24148892 - 24161416
Public Clones CC0074 (sanger) A042A03 (ggtc) D074E11 (ggtc) D074E11 (ggtc) IST14900E4 (tigm)
IST14675A5 (tigm)
Private Clones OST446019 (lexicon) OST150188 (lexicon) OST150171 (lexicon) OST150127 (lexicon)
OST142970 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000572974 (Chr18:24148679..24148891 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTCCAGTTGTGCCCTAT Chr18:24148825..24148844 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000572974 (Chr18:24148679..24148891 +)
Downstram Exon
ENSMUSE00000582915 (Chr18:24161417..24161621 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTCCAGTTGTGCCCTAT Chr18:24148825..24148844 59.85 55 CCTTGCCACACTCATCACAC Chr18:24161606..24161625 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000572975 Chr18:24148182..24148232 No primer for this exon
upstream ENSMUSE00000572974 Chr18:24148679..24148891 GGTGTCCAGTTGTGCCCTAT Chr18:24148825..24148844 59.85 55

*** Putative Vector Insertion (Chr 18: 24148892 - 24161416) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494905 Chr18:24161151..24163230 AACCGCGACTGAAGCTTTTA Chr18:24162377..24162396 60.02 45
downstream ENSMUSE00000582915 Chr18:24161417..24161621 CCTTGCCACACTCATCACAC Chr18:24161606..24161625 60.16 55
downstream ENSMUSE00000704300 Chr18:24162126..24162186 CGGTGTGAATTCGTTGATGA Chr18:24162158..24162177 60.52 45
downstream ENSMUSE00000704299 Chr18:24162439..24162499 CCCAGAATGCACTCTCTGATGT Chr18:24162494..24162515 61.61 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTGAGCCTCAGTGCATTT Chr18:24160891..24160911 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATTCTTCTGGCGTGACTGG Chr18:24160931..24160952 61.73 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063281