Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18060
Trapped Gene
Gltscr1 (ENSMUSG00000070808)
Vector Insertion
Chr 7: 16561163 - 16562399
Public Clones E122D05 (ggtc)
Private Clones OST431073 (lexicon) OST330274 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677012 (Chr7:16562400..16562461 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACTGCAACCCAGCAAAGAA Chr7:16562405..16562424 59.46 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677012 (Chr7:16562400..16562461 -)
Downstram Exon
ENSMUSE00000599917 (Chr7:16561014..16561162 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACTGCAACCCAGCAAAGAA Chr7:16562405..16562424 59.46 45 GTCTTGTAATCGGGGTGCAG Chr7:16561084..16561103 60.52 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677016 Chr7:16584743..16584844 CACCCTTCCCTTCATGATTC Chr7:16584756..16584775 59.34 50
upstream ENSMUSE00000677015 Chr7:16581900..16581945 ATGATGAGGATGGGAGATGC Chr7:16581917..16581936 59.85 50
upstream ENSMUSE00000637122 Chr7:16581750..16581792 TCAGGCCCTCAATGATTTCT Chr7:16581767..16581786 59.63 45
upstream ENSMUSE00000677014 Chr7:16578429..16578494 GCCCAAAGTGCCTTCTATGA Chr7:16578439..16578458 60.21 50
upstream ENSMUSE00000637120 Chr7:16572828..16574789 ACCACACTCAACGGGAACTC Chr7:16574026..16574045 60.01 55
upstream ENSMUSE00000599922 Chr7:16572262..16572438 CTGCCTCCGTCATAGTCAGC Chr7:16572370..16572389 60.97 60
upstream ENSMUSE00000599921 Chr7:16564700..16565335 ACCTGGCATCTTTGTCATCC Chr7:16565083..16565102 59.93 50
upstream ENSMUSE00000599920 Chr7:16564364..16564544 TAGTCAGTGGACAGGCACCA Chr7:16564422..16564441 60.31 55
upstream ENSMUSE00000677013 Chr7:16564038..16564147 CCTCTACTTCCTGCCGAAAA Chr7:16564120..16564139 59.45 50
upstream ENSMUSE00000677012 Chr7:16562400..16562461 TACTGCAACCCAGCAAAGAA Chr7:16562405..16562424 59.46 45

*** Putative Vector Insertion (Chr 7: 16561163 - 16562399) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599917 Chr7:16561014..16561162 GTCTTGTAATCGGGGTGCAG Chr7:16561084..16561103 60.52 55
downstream ENSMUSE00000599916 Chr7:16560715..16560809 TTGAGCAGCTGCGTAGAGAC Chr7:16560748..16560767 59.49 55
downstream ENSMUSE00000599915 Chr7:16560432..16560534 TCTCCGCAGAAGGACTGACT Chr7:16560491..16560510 60.13 55
downstream ENSMUSE00000599914 Chr7:16556611..16558238 GGTGAGTGCACGTATGGATG Chr7:16556616..16556635 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCATCCCCACTGCTCTAA Chr7:16562345..16562365 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAACAGCCCCTACTGCAAC Chr7:16562414..16562434 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTTGAAGAAACAGCCCCTA Chr7:16562421..16562441 59.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTTGAAGAAACAGCCCCTA Chr7:16562421..16562441 59.45 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070808