Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18068
Trapped Gene
Rnaseh2b (ENSMUSG00000021932)
Vector Insertion
Chr 14: 62969314 - 62972359
Public Clones not available
Private Clones OST430979 (lexicon) OST181447 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000122217 (Chr14:62969237..62969313 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTAAAGGCTGGCAAAGAG Chr14:62969294..62969313 59.59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000122217 (Chr14:62969237..62969313 +)
Downstram Exon
ENSMUSE00000122213 (Chr14:62972360..62972474 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTAAAGGCTGGCAAAGAG Chr14:62969294..62969313 59.59 50 CATGCCGAAGTGACTTTTCA Chr14:62972462..62972481 59.84 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445440 Chr14:62950941..62951013 CCAGGCAGCTAGTGTTCCTA Chr14:62950987..62951006 58.13 55
upstream ENSMUSE00000122211 Chr14:62965405..62965479 GCCTCCTGTTCGTAAAGCTG Chr14:62965444..62965463 60.01 55
upstream ENSMUSE00000445402 Chr14:62967358..62967465 No primer for this exon
upstream ENSMUSE00000122217 Chr14:62969237..62969313 TCCTAAAGGCTGGCAAAGAG Chr14:62969294..62969313 59.59 50

*** Putative Vector Insertion (Chr 14: 62969314 - 62972359) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122213 Chr14:62972360..62972474 CATGCCGAAGTGACTTTTCA Chr14:62972462..62972481 59.84 45
downstream ENSMUSE00000445391 Chr14:62979300..62979364 TCTCCAGCCACTTCAATGTC Chr14:62979362..62979381 58.8 50
downstream ENSMUSE00000280565 Chr14:62980166..62980271 GGAAACCTGACCACCAGAGA Chr14:62980261..62980280 60.09 55
downstream ENSMUSE00000122206 Chr14:62982867..62982948 CATGGGCATAGCGAACATAA Chr14:62982893..62982912 59.54 45
downstream ENSMUSE00000122207 Chr14:62984096..62984138 AGGGTTGGTCAATGAAGCTG Chr14:62984132..62984151 60.11 50
downstream ENSMUSE00000122212 Chr14:62989309..62989389 TGCCGGTCTTCAAGTCTTTAG Chr14:62989389..62989409 59.5 47.62
downstream ENSMUSE00000336995 Chr14:62991197..62991337 CTGAGCTGCAGTCATTTTGC Chr14:62991226..62991245 59.75 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTTCAGTAATCGCCTTG Chr14:62972352..62972372 59.7 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGTCCCTTTCAGCGTGAC Chr14:62972347..62972367 60.67 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021932