Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18069
Trapped Gene
Mrps18c (ENSMUSG00000016833)
Vector Insertion
Chr 5: 101227880 - 101228570
Public Clones IST10881E7 (tigm) IST11945H12HMF2 (tigm)
Private Clones OST430955 (lexicon) OST324590 (lexicon) OST60289 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000406709 (Chr5:101227766..101227879 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000406709 (Chr5:101227766..101227879 +)
Downstram Exon
ENSMUSE00000187942 (Chr5:101228571..101228632 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693554 Chr5:101227756..101227879 No primer for this exon
upstream ENSMUSE00000693565 Chr5:101227762..101227879 No primer for this exon
upstream ENSMUSE00000406709 Chr5:101227766..101227879 No primer for this exon

*** Putative Vector Insertion (Chr 5: 101227880 - 101228570) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000187942 Chr5:101228571..101228632 No primer for this exon
downstream ENSMUSE00000187941 Chr5:101230927..101231010 No primer for this exon
downstream ENSMUSE00000187937 Chr5:101232072..101232129 No primer for this exon
downstream ENSMUSE00000187936 Chr5:101232989..101233048 No primer for this exon
downstream ENSMUSE00000693553 Chr5:101232989..101233048 No primer for this exon
downstream ENSMUSE00000693555 Chr5:101232989..101233490 No primer for this exon
downstream ENSMUSE00000353655 Chr5:101233351..101233477 No primer for this exon
downstream ENSMUSE00000693551 Chr5:101233351..101233480 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCTCTAATCGCCTTGCAG Chr5:101227925..101227945 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000016833