Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18073
Trapped Gene
Cntfr (ENSMUSG00000028444)
Vector Insertion
Chr 4: 41618109 - 41622051
Public Clones (sanger)
Private Clones OST430883 (lexicon) OST310980 (lexicon) OST285794 (lexicon) OST252592 (lexicon)
OST218024 (lexicon) OST136084 (lexicon) OST79917 (lexicon) OST78472 (lexicon)
OST65518 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711160 (Chr4:41622052..41622136 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCTGTCTACACGCAGAAAC Chr4:41622064..41622083 59.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711160 (Chr4:41622052..41622136 -)
Downstram Exon
ENSMUSE00000416099 (Chr4:41617875..41618108 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCTGTCTACACGCAGAAAC Chr4:41622064..41622083 59.66 55 TATCAGCTGAGAGCCGTTGA Chr4:41617947..41617966 59.7 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660886 Chr4:41644010..41644074 GTCTGTATCCTGGGGAGCTG Chr4:41644012..41644031 59.68 60
upstream ENSMUSE00000675346 Chr4:41644010..41644123 ATCACCAACGCTCCGTATTT Chr4:41644074..41644093 59.46 45
upstream ENSMUSE00000660882 Chr4:41642343..41642474 No primer for this exon
upstream ENSMUSE00000675345 Chr4:41642343..41642477 No primer for this exon
upstream ENSMUSE00000660885 Chr4:41633829..41633918 CCAGGAAGACTTTGGTCTGG Chr4:41633877..41633896 59.69 55
upstream ENSMUSE00000605086 Chr4:41622052..41622136 CGCTGTCTACACGCAGAAAC Chr4:41622064..41622083 59.66 55
upstream ENSMUSE00000711160 Chr4:41622052..41622136 CGCTGTCTACACGCAGAAAC Chr4:41622064..41622083 59.66 55

*** Putative Vector Insertion (Chr 4: 41618109 - 41622051) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000416099 Chr4:41617875..41618108 TATCAGCTGAGAGCCGTTGA Chr4:41617947..41617966 59.7 50
downstream ENSMUSE00000632943 Chr4:41616706..41616860 CTCCTCGAGGTTTCCATCAG Chr4:41616749..41616768 59.8 55
downstream ENSMUSE00000294045 Chr4:41610571..41610688 AAGCCCTTGGGGTAAGTGTT Chr4:41610612..41610631 59.86 50
downstream ENSMUSE00000179195 Chr4:41610233..41610399 GTGATGGCCGTAGTGTTGTG Chr4:41610231..41610250 60.03 55
downstream ENSMUSE00000179194 Chr4:41609004..41609167 CACCACGTTTTCTGGAGGAT Chr4:41609117..41609136 59.97 50
downstream ENSMUSE00000179193 Chr4:41605812..41605992 CACTCCATGTCCCAATCTCA Chr4:41605865..41605884 59.47 50
downstream ENSMUSE00000660884 Chr4:41605272..41605440 GGGTCACAGATCTTCGTGGT Chr4:41605358..41605377 59.97 55
downstream ENSMUSE00000660883 Chr4:41604532..41605183 TAGCTGCATGGTCCTCCTCT Chr4:41604932..41604951 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACAGTCCACAGGGTGAGTG Chr4:41619043..41619063 60.2 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGTCCACAGGGTGAGTG Chr4:41619043..41619063 60.2 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr4:41619067..41619087 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACAGATGGCTGCTTCTGTCC Chr4:41622119..41622139 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028444