Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18078
Trapped Gene
Rassf1 (ENSMUSG00000010067)
Vector Insertion
Chr 9: 107459889 - 107460100
Public Clones not available
Private Clones OST430802 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221062 (Chr9:107459784..107459888 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221062 (Chr9:107459784..107459888 +)
Downstram Exon
ENSMUSE00000221059 (Chr9:107460101..107460398 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716703 Chr9:107453898..107454177 No primer for this exon
upstream ENSMUSE00000583263 Chr9:107453928..107454177 No primer for this exon
upstream ENSMUSE00000720513 Chr9:107456457..107456575 No primer for this exon
upstream ENSMUSE00000583262 Chr9:107456469..107456575 No primer for this exon
upstream ENSMUSE00000254340 Chr9:107457090..107457256 No primer for this exon
upstream ENSMUSE00000710890 Chr9:107458942..107459082 No primer for this exon
upstream ENSMUSE00000221062 Chr9:107459784..107459888 No primer for this exon

*** Putative Vector Insertion (Chr 9: 107459889 - 107460100) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221059 Chr9:107460101..107460398 No primer for this exon
downstream ENSMUSE00000221063 Chr9:107460518..107460633 No primer for this exon
downstream ENSMUSE00000254319 Chr9:107463730..107464591 No primer for this exon
downstream ENSMUSE00000720089 Chr9:107463730..107464594 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAGGAATGTGGGAGAACA Chr9:107459902..107459922 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAGGAATGTGGGAGAACA Chr9:107459902..107459922 59.06 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010067