Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18092
Trapped Gene
Golim4 (ENSMUSG00000034109)
Vector Insertion
Chr 3: 75715572 - 75760033
Public Clones not available
Private Clones OST430517 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225287 (Chr3:75760034..75760857 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGTGTCCAGCTACTTCTC Chr3:75760309..75760328 60.02 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225287 (Chr3:75760034..75760857 -)
Downstram Exon
ENSMUSE00000225280 (Chr3:75715497..75715571 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGTGTCCAGCTACTTCTC Chr3:75760309..75760328 60.02 60 TGTTCAAGCCTTTCTTTTTGC Chr3:75715492..75715512 59.51 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225287 Chr3:75760034..75760857 GCCGTGTCCAGCTACTTCTC Chr3:75760309..75760328 60.02 60
upstream ENSMUSE00000720413 Chr3:75760034..75760871 GCCGTGTCCAGCTACTTCTC Chr3:75760309..75760328 60.02 60

*** Putative Vector Insertion (Chr 3: 75715572 - 75760033) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000225280 Chr3:75715497..75715571 TGTTCAAGCCTTTCTTTTTGC Chr3:75715492..75715512 59.51 38.1
downstream ENSMUSE00000225273 Chr3:75713931..75713980 No primer for this exon
downstream ENSMUSE00000225268 Chr3:75712052..75712105 No primer for this exon
downstream ENSMUSE00000225259 Chr3:75710321..75710471 GGTGTTCCTCTTCCAGGTCA Chr3:75710398..75710417 60.09 55
downstream ENSMUSE00000225254 Chr3:75707169..75707251 TGACGTCTTGAAGCTGTGTG Chr3:75707149..75707168 58.57 50
downstream ENSMUSE00000711388 Chr3:75706323..75706406 GCTGTTCATGCTCGGAGAGT Chr3:75706348..75706367 60.56 55
downstream ENSMUSE00000225241 Chr3:75701893..75702054 CTCGACTGGGTCAGGATTTC Chr3:75701955..75701974 59.65 55
downstream ENSMUSE00000225233 Chr3:75698757..75699059 CAGTCTCGATCCTGCTCCTC Chr3:75698793..75698812 60.1 60
downstream ENSMUSE00000225224 Chr3:75696705..75696958 TCTTCATGGGCTACCTGCTT Chr3:75696713..75696732 59.84 50
downstream ENSMUSE00000225219 Chr3:75695811..75695893 ACTCCCTGTGCGATGTCATT Chr3:75695824..75695843 60.54 50
downstream ENSMUSE00000225211 Chr3:75694444..75694553 GGTGTCCTGGTTCACGAAGT Chr3:75694451..75694470 60.01 55
downstream ENSMUSE00000225204 Chr3:75690595..75690762 ATCTTCGCCTTGATTGTTGG Chr3:75690684..75690703 60.07 45
downstream ENSMUSE00000225200 Chr3:75690197..75690265 CTTCCTCTCCTTCGTCCTGA Chr3:75690177..75690196 59.53 55
downstream ENSMUSE00000225195 Chr3:75682568..75682639 TTATGCTCCATTTCCCGTTT Chr3:75682571..75682590 59.41 40
downstream ENSMUSE00000393108 Chr3:75680389..75682099 GCTTCGCATGCTTTCCTATC Chr3:75681009..75681028 59.95 50
downstream ENSMUSE00000708824 Chr3:75680105..75682099 GCTTCGCATGCTTTCCTATC Chr3:75681009..75681028 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATAATCGCCTTGCAGCAC Chr3:75750965..75750985 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCTGTCTCCTGCTGCATA Chr3:75751012..75751032 59.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034109