Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18113
Trapped Gene
Rsrc1 (ENSMUSG00000034544)
Vector Insertion
Chr 3: 66798438 - 66798635
Public Clones not available
Private Clones OST429927 (lexicon) OST278698 (lexicon) OST168122 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639028 (Chr3:66798439..66798634 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTCGCTCGCATTCTTAT Chr3:66798607..66798626 59.23 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639028 (Chr3:66798439..66798634 +)
Downstram Exon
ENSMUSE00000500105 (Chr3:66798439..66798634 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTCGCTCGCATTCTTAT Chr3:66798607..66798626 59.23 45 TGAAGAGCTGCTTGAAGACG Chr3:66798533..66798552 59.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639029 Chr3:66789594..66789728 AAGGCGCTGAGCTTAAATTG Chr3:66789617..66789636 59.63 45
upstream ENSMUSE00000450685 Chr3:66789891..66790011 GCTTGGCCTACAGTGTGGAG Chr3:66789979..66789998 60.85 60

*** Putative Vector Insertion (Chr 3: 66798438 - 66798635) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000500105 Chr3:66798439..66798634 TGAAGAGCTGCTTGAAGACG Chr3:66798533..66798552 59.47 50
downstream ENSMUSE00000639028 Chr3:66798439..66798634 TGAAGAGCTGCTTGAAGACG Chr3:66798533..66798552 59.47 50
downstream ENSMUSE00000232676 Chr3:66800387..66800512 GGAACGACTGCGACTTCTTT Chr3:66800456..66800475 59.48 50
downstream ENSMUSE00000639027 Chr3:66886458..66886631 TCCCGGACTTTACGTCTGTC Chr3:66886568..66886587 60.11 55
downstream ENSMUSE00000639026 Chr3:66984751..66984787 No primer for this exon
downstream ENSMUSE00000639025 Chr3:67010348..67010399 GCTTCAAGGACCAATTGCAG Chr3:67010397..67010416 60.78 50
downstream ENSMUSE00000639024 Chr3:67094269..67094337 No primer for this exon
downstream ENSMUSE00000639023 Chr3:67153831..67153937 TGTTCTACCAGGGTGGCTTG Chr3:67153855..67153874 61.08 55
downstream ENSMUSE00000450607 Chr3:67155618..67155674 CCATCATGTCTTCCCAGGAC Chr3:67155640..67155659 60.33 55
downstream ENSMUSE00000639022 Chr3:67159396..67159548 ACATGCTGCACTTCACTTGG Chr3:67159427..67159446 59.9 50
downstream ENSMUSE00000639021 Chr3:67160143..67162325 GTCTCTTTGCTTCCCGACAG Chr3:67161167..67161186 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAAGAGGAAAGCAGAAGCA Chr3:66798464..66798485 59.88 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAAGCAAGAGCGTGACTG Chr3:66798477..66798497 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034544