Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI18114
Trapped Gene
Myo5c (ENSMUSG00000033590)
Vector Insertion
Chr 9: 75151736 - 75153259
Public Clones not available
Private Clones OST429905 (lexicon) OST393377 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695742 (Chr9:75151737..75153258 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGGAGGGATGCAGTTATT Chr9:75151938..75151957 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695742 (Chr9:75151737..75153258 +)
Downstram Exon
ENSMUSE00000583938 (Chr9:75151737..75153258 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGGAGGGATGCAGTTATT Chr9:75151938..75151957 59.96 50 TTTGGAAAGCCATCATGTCA Chr9:75153199..75153218 60.05 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583940 Chr9:75079821..75079982 ACTCGGGAAAACTTCTGCAC Chr9:75079867..75079886 59.33 50
upstream ENSMUSE00000695775 Chr9:75089452..75089471 No primer for this exon
upstream ENSMUSE00000695773 Chr9:75090565..75090679 AAGGACTACAGAGCGGGTGA Chr9:75090626..75090645 59.87 55
upstream ENSMUSE00000426116 Chr9:75090569..75090679 AAGGACTACAGAGCGGGTGA Chr9:75090626..75090645 59.87 55
upstream ENSMUSE00000386734 Chr9:75092777..75092942 TGGGTGAGAATGACCTCACA Chr9:75092838..75092857 60.09 50
upstream ENSMUSE00000531815 Chr9:75093945..75094089 GCCTACAGCGGACAGAACAT Chr9:75094010..75094029 60.28 55
upstream ENSMUSE00000402794 Chr9:75097540..75097696 GGCATCCAATCCCATAACTG Chr9:75097675..75097694 60.15 50
upstream ENSMUSE00000531814 Chr9:75098180..75098323 AGCAGTCGGTTTGGGAAATA Chr9:75098216..75098235 59.57 45
upstream ENSMUSE00000277614 Chr9:75099248..75099329 TCTACCAGCTTTGTGCATCC Chr9:75099276..75099295 58.88 50
upstream ENSMUSE00000425684 Chr9:75100331..75100438 ACATGGTGGAGACCCAGAAG Chr9:75100403..75100422 59.96 55
upstream ENSMUSE00000277562 Chr9:75103638..75103744 GGCAACGAGAGGTCTTCAGT Chr9:75103721..75103740 59.46 55
upstream ENSMUSE00000277538 Chr9:75105766..75106031 GCTGGCCAAAAAGATCTACG Chr9:75105918..75105937 59.85 50
upstream ENSMUSE00000277514 Chr9:75110015..75110096 CAGCTTTGAACAGTTCTGCATC Chr9:75110036..75110057 60.06 45.46
upstream ENSMUSE00000277496 Chr9:75110792..75110932 ACCTGATCGAGGCAAAAATG Chr9:75110880..75110899 60.07 45
upstream ENSMUSE00000277438 Chr9:75113875..75114000 CACCGATGAAAACTGGCTTC Chr9:75113886..75113905 60.64 50
upstream ENSMUSE00000277419 Chr9:75114832..75114915 ACCAATGTGAAGGGTTCCTG Chr9:75114839..75114858 59.82 50
upstream ENSMUSE00000277398 Chr9:75117328..75117462 AAAGCCCTGTTCCGTCTTCT Chr9:75117356..75117375 60.25 50
upstream ENSMUSE00000277379 Chr9:75118076..75118173 CTCATGGAAACCCTCAATGC Chr9:75118097..75118116 60.46 50
upstream ENSMUSE00000277354 Chr9:75119350..75119436 TTTGACTCCAAGCGGATTGT Chr9:75119351..75119370 60.64 45
upstream ENSMUSE00000277335 Chr9:75120652..75120763 AGAAGGAGGTGTGCAAGGTG Chr9:75120723..75120742 60.3 55
upstream ENSMUSE00000425616 Chr9:75121316..75121527 TTAGAGAAACTCCGCCTGGA Chr9:75121379..75121398 59.95 50
upstream ENSMUSE00000277290 Chr9:75123278..75123443 GGCTACCTGGTCCGTAACCT Chr9:75123345..75123364 60.38 60
upstream ENSMUSE00000277261 Chr9:75123709..75123855 AGGTTCGTGCTCAACATTCA Chr9:75123790..75123809 59.29 45
upstream ENSMUSE00000277232 Chr9:75124739..75124903 AGGTTCAGAAGCTGGAAGCA Chr9:75124809..75124828 60.13 50
upstream ENSMUSE00000713866 Chr9:75126032..75126125 GTCAAAGCTGCAGAAGCACA Chr9:75126037..75126056 60.33 50
upstream ENSMUSE00000718767 Chr9:75126032..75126125 GTCAAAGCTGCAGAAGCACA Chr9:75126037..75126056 60.33 50
upstream ENSMUSE00000583939 Chr9:75127143..75127206 GCTGTTTGATGATGTGCAGAA Chr9:75127168..75127188 59.86 42.86
upstream ENSMUSE00000695770 Chr9:75127143..75127206 GCTGTTTGATGATGTGCAGAA Chr9:75127168..75127188 59.86 42.86
upstream ENSMUSE00000531813 Chr9:75129643..75129823 TAAAGCCCTCAAGGACGAGA Chr9:75129715..75129734 59.95 50
upstream ENSMUSE00000695769 Chr9:75129643..75129823 TAAAGCCCTCAAGGACGAGA Chr9:75129715..75129734 59.95 50
upstream ENSMUSE00000531812 Chr9:75131700..75131793 AAAAGCACGTGCAGTCACAG Chr9:75131758..75131777 60.1 50
upstream ENSMUSE00000695768 Chr9:75131700..75131793 AAAAGCACGTGCAGTCACAG Chr9:75131758..75131777 60.1 50
upstream ENSMUSE00000531811 Chr9:75131954..75132017 GAGGTCACCAAGCAGCTTTT Chr9:75131965..75131984 59.48 50
upstream ENSMUSE00000695766 Chr9:75131954..75132017 GAGGTCACCAAGCAGCTTTT Chr9:75131965..75131984 59.48 50
upstream ENSMUSE00000531810 Chr9:75132740..75132820 TGGTTTGCCTACGAAGGACT Chr9:75132786..75132805 59.73 50
upstream ENSMUSE00000695765 Chr9:75132740..75132820 TGGTTTGCCTACGAAGGACT Chr9:75132786..75132805 59.73 50
upstream ENSMUSE00000531809 Chr9:75134218..75134398 TTCAAAGTCGTGCACCTGAG Chr9:75134282..75134301 60.03 50
upstream ENSMUSE00000695763 Chr9:75134218..75134398 TTCAAAGTCGTGCACCTGAG Chr9:75134282..75134301 60.03 50
upstream ENSMUSE00000531808 Chr9:75135856..75135949 CTGAAGGAGCAGGCTGAGAA Chr9:75135922..75135941 60.81 55
upstream ENSMUSE00000695761 Chr9:75135856..75135949 CTGAAGGAGCAGGCTGAGAA Chr9:75135922..75135941 60.81 55
upstream ENSMUSE00000531807 Chr9:75136700..75136763 TGAACCGAATCCGAGAAGAG Chr9:75136727..75136746 60.33 50
upstream ENSMUSE00000695759 Chr9:75136700..75136763 TGAACCGAATCCGAGAAGAG Chr9:75136727..75136746 60.33 50
upstream ENSMUSE00000531806 Chr9:75136866..75137034 GAAGCCATCAAGTTCCCAAA Chr9:75136939..75136958 60.05 45
upstream ENSMUSE00000695757 Chr9:75136866..75137034 GAAGCCATCAAGTTCCCAAA Chr9:75136939..75136958 60.05 45
upstream ENSMUSE00000531805 Chr9:75138656..75138743 TCTGACCAAGACGACTGAGAAA Chr9:75138721..75138742 60.03 45.46
upstream ENSMUSE00000695756 Chr9:75138656..75138743 TCTGACCAAGACGACTGAGAAA Chr9:75138721..75138742 60.03 45.46
upstream ENSMUSE00000531804 Chr9:75139961..75140059 GGGGATGCTGGAATACAAGA Chr9:75140001..75140020 59.89 50
upstream ENSMUSE00000695754 Chr9:75139961..75140059 GGGGATGCTGGAATACAAGA Chr9:75140001..75140020 59.89 50
upstream ENSMUSE00000531803 Chr9:75141733..75141887 GCTATTAACGGCATCAAGCA Chr9:75141858..75141877 58.94 45
upstream ENSMUSE00000695753 Chr9:75141733..75141887 GCTATTAACGGCATCAAGCA Chr9:75141858..75141877 58.94 45
upstream ENSMUSE00000531802 Chr9:75142969..75143058 TGAAGCAGTACAGCGGAGAA Chr9:75143036..75143055 59.74 50
upstream ENSMUSE00000695751 Chr9:75142969..75143058 TGAAGCAGTACAGCGGAGAA Chr9:75143036..75143055 59.74 50
upstream ENSMUSE00000531801 Chr9:75143817..75143967 AAACAACCTCCAGCCGATAA Chr9:75143945..75143964 59.57 45
upstream ENSMUSE00000695749 Chr9:75143817..75143967 AAACAACCTCCAGCCGATAA Chr9:75143945..75143964 59.57 45
upstream ENSMUSE00000531800 Chr9:75145211..75145493 TCGACGACACAGATGCCTAC Chr9:75145292..75145311 59.86 55
upstream ENSMUSE00000695748 Chr9:75145211..75145493 TCGACGACACAGATGCCTAC Chr9:75145292..75145311 59.86 55
upstream ENSMUSE00000531799 Chr9:75148613..75148787 TGCAGGTGAAGAAGACCACA Chr9:75148714..75148733 60.44 50
upstream ENSMUSE00000695747 Chr9:75148613..75148787 TGCAGGTGAAGAAGACCACA Chr9:75148714..75148733 60.44 50
upstream ENSMUSE00000531798 Chr9:75149211..75149291 CCTTCGTCCGCAAAGTACAG Chr9:75149272..75149291 60.82 55
upstream ENSMUSE00000695746 Chr9:75149211..75149291 CCTTCGTCCGCAAAGTACAG Chr9:75149272..75149291 60.82 55

*** Putative Vector Insertion (Chr 9: 75151736 - 75153259) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583938 Chr9:75151737..75153258 TTTGGAAAGCCATCATGTCA Chr9:75153199..75153218 60.05 40
downstream ENSMUSE00000695742 Chr9:75151737..75153258 TTTGGAAAGCCATCATGTCA Chr9:75153199..75153218 60.05 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:75151786..75151806 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTGATGCTGGATACCAC Chr9:75151768..75151788 59.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033590